Incidental Mutation 'R4447:Map2k3'
ID 328806
Institutional Source Beutler Lab
Gene Symbol Map2k3
Ensembl Gene ENSMUSG00000018932
Gene Name mitogen-activated protein kinase kinase 3
Synonyms MAP kinase kinase 3, MKK3, Prkmk3
MMRRC Submission 041708-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4447 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 60822880-60843637 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60837997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 253 (S253C)
Ref Sequence ENSEMBL: ENSMUSP00000019076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019076] [ENSMUST00000130269]
AlphaFold O09110
PDB Structure CRYSTAL STRUCTURE OF MAP KINASE P38 COMPLEXED TO THE DOCKING SITE ON ITS ACTIVATOR MKK3B [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019076
AA Change: S253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019076
Gene: ENSMUSG00000018932
AA Change: S253C

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
S_TKc 64 325 1.41e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126043
Predicted Effect probably benign
Transcript: ENSMUST00000130269
SMART Domains Protein: ENSMUSP00000114430
Gene: ENSMUSG00000018932

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Pkinase 64 173 1.3e-12 PFAM
Pfam:Pkinase_Tyr 64 173 3.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145828
Meta Mutation Damage Score 0.9261 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but display abnormalities in cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,976,129 (GRCm39) noncoding transcript Het
Acsf2 G T 11: 94,460,185 (GRCm39) P389Q possibly damaging Het
Aldh6a1 A G 12: 84,486,483 (GRCm39) V120A possibly damaging Het
Alg11 C A 8: 22,558,095 (GRCm39) A469E probably benign Het
Ankar A G 1: 72,726,948 (GRCm39) S415P possibly damaging Het
Ano3 A T 2: 110,591,923 (GRCm39) probably null Het
Asic4 A T 1: 75,447,014 (GRCm39) probably benign Het
Atp1a4 A C 1: 172,061,998 (GRCm39) I709S probably damaging Het
Cyp11b2 T C 15: 74,727,412 (GRCm39) I90V probably benign Het
Galnt2 A G 8: 125,022,116 (GRCm39) D14G probably benign Het
Iqcm T C 8: 76,356,394 (GRCm39) S176P probably damaging Het
Irf5 T A 6: 29,535,941 (GRCm39) D318E probably damaging Het
Mgst1 G T 6: 138,118,662 (GRCm39) probably benign Het
Mipol1 G T 12: 57,399,534 (GRCm39) probably benign Het
Niban1 A T 1: 151,512,153 (GRCm39) probably null Het
Or7c19 T A 8: 85,957,995 (GRCm39) Y290* probably null Het
Pomgnt1 G T 4: 116,010,120 (GRCm39) V161L possibly damaging Het
Rnpc3 T C 3: 113,404,786 (GRCm39) probably benign Het
Rxfp1 C T 3: 79,559,434 (GRCm39) probably benign Het
Scn5a T C 9: 119,379,693 (GRCm39) D197G probably damaging Het
Spata31d1e T C 13: 59,890,012 (GRCm39) T603A probably benign Het
Thsd7a G A 6: 12,324,634 (GRCm39) T1479I probably damaging Het
Twsg1 C T 17: 66,236,782 (GRCm39) D83N possibly damaging Het
Ubqln3 C T 7: 103,792,021 (GRCm39) R23Q probably benign Het
Vmn1r228 T C 17: 20,997,369 (GRCm39) I50V probably damaging Het
Wnk4 T A 11: 101,159,277 (GRCm39) S565T possibly damaging Het
Wwc2 A G 8: 48,321,702 (GRCm39) Y471H unknown Het
Zfp407 A T 18: 84,580,819 (GRCm39) V98D possibly damaging Het
Zfp598 T A 17: 24,895,529 (GRCm39) V73E probably damaging Het
Zscan29 T A 2: 121,000,367 (GRCm39) probably null Het
Other mutations in Map2k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Map2k3 APN 11 60,834,041 (GRCm39) missense possibly damaging 0.54
IGL00901:Map2k3 APN 11 60,832,747 (GRCm39) missense probably benign 0.00
IGL01620:Map2k3 APN 11 60,840,873 (GRCm39) missense possibly damaging 0.86
IGL02197:Map2k3 APN 11 60,837,590 (GRCm39) missense probably damaging 1.00
R1907:Map2k3 UTSW 11 60,823,055 (GRCm39) missense possibly damaging 0.70
R2069:Map2k3 UTSW 11 60,840,853 (GRCm39) missense probably damaging 1.00
R5106:Map2k3 UTSW 11 60,832,708 (GRCm39) missense probably damaging 0.97
R5163:Map2k3 UTSW 11 60,834,317 (GRCm39) missense probably damaging 1.00
R6043:Map2k3 UTSW 11 60,837,572 (GRCm39) missense probably benign 0.01
R6147:Map2k3 UTSW 11 60,840,776 (GRCm39) nonsense probably null
R6659:Map2k3 UTSW 11 60,833,150 (GRCm39) missense probably benign 0.45
R7206:Map2k3 UTSW 11 60,834,406 (GRCm39) missense
R7261:Map2k3 UTSW 11 60,836,393 (GRCm39) splice site probably null
R7389:Map2k3 UTSW 11 60,822,862 (GRCm39) unclassified probably benign
R8998:Map2k3 UTSW 11 60,840,817 (GRCm39) missense
R8999:Map2k3 UTSW 11 60,840,817 (GRCm39) missense
R9355:Map2k3 UTSW 11 60,823,055 (GRCm39) missense possibly damaging 0.73
R9729:Map2k3 UTSW 11 60,837,472 (GRCm39) missense
R9746:Map2k3 UTSW 11 60,822,929 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATCATGCAGGCAGGAGAACC -3'
(R):5'- CATTGCCTGGGATTTCCTGATC -3'

Sequencing Primer
(F):5'- TATCATGCAGGCAGGAGAACCTAATG -3'
(R):5'- TGATCTACACCAGTGGCTCTAGAG -3'
Posted On 2015-07-21