Incidental Mutation 'R4447:Map2k3'
ID328806
Institutional Source Beutler Lab
Gene Symbol Map2k3
Ensembl Gene ENSMUSG00000018932
Gene Namemitogen-activated protein kinase kinase 3
SynonymsMKK3, Prkmk3, MAP kinase kinase 3
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60932033-60952811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60947171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 253 (S253C)
Ref Sequence ENSEMBL: ENSMUSP00000019076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019076] [ENSMUST00000130269]
PDB Structure
CRYSTAL STRUCTURE OF MAP KINASE P38 COMPLEXED TO THE DOCKING SITE ON ITS ACTIVATOR MKK3B [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019076
AA Change: S253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019076
Gene: ENSMUSG00000018932
AA Change: S253C

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
S_TKc 64 325 1.41e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126043
Predicted Effect probably benign
Transcript: ENSMUST00000130269
SMART Domains Protein: ENSMUSP00000114430
Gene: ENSMUSG00000018932

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Pkinase 64 173 1.3e-12 PFAM
Pfam:Pkinase_Tyr 64 173 3.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145828
Meta Mutation Damage Score 0.9261 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but display abnormalities in cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Map2k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Map2k3 APN 11 60943215 missense possibly damaging 0.54
IGL00901:Map2k3 APN 11 60941921 missense probably benign 0.00
IGL01620:Map2k3 APN 11 60950047 missense possibly damaging 0.86
IGL02197:Map2k3 APN 11 60946764 missense probably damaging 1.00
R1907:Map2k3 UTSW 11 60932229 missense possibly damaging 0.70
R2069:Map2k3 UTSW 11 60950027 missense probably damaging 1.00
R5106:Map2k3 UTSW 11 60941882 missense probably damaging 0.97
R5163:Map2k3 UTSW 11 60943491 missense probably damaging 1.00
R6043:Map2k3 UTSW 11 60946746 missense probably benign 0.01
R6147:Map2k3 UTSW 11 60949950 nonsense probably null
R6659:Map2k3 UTSW 11 60942324 missense probably benign 0.45
R7206:Map2k3 UTSW 11 60943580 missense
R7261:Map2k3 UTSW 11 60945567 splice site probably null
R7389:Map2k3 UTSW 11 60932036 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TATCATGCAGGCAGGAGAACC -3'
(R):5'- CATTGCCTGGGATTTCCTGATC -3'

Sequencing Primer
(F):5'- TATCATGCAGGCAGGAGAACCTAATG -3'
(R):5'- TGATCTACACCAGTGGCTCTAGAG -3'
Posted On2015-07-21