Incidental Mutation 'R4447:Aldh6a1'
ID 328810
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Name aldehyde dehydrogenase family 6, subfamily A1
Synonyms Mmsdh, 1110038I05Rik
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock # R4447 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 84430717-84451004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84439709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000152269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
AlphaFold Q9EQ20
Predicted Effect probably benign
Transcript: ENSMUST00000085192
AA Change: V145A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: V145A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220491
AA Change: V120A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222656
Meta Mutation Damage Score 0.1341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 splice site probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84439529 missense probably damaging 1.00
R4351:Aldh6a1 UTSW 12 84443761 missense probably benign 0.00
R5205:Aldh6a1 UTSW 12 84439644 missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R6849:Aldh6a1 UTSW 12 84443787 missense probably benign 0.00
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84441831 missense probably benign 0.19
R7417:Aldh6a1 UTSW 12 84441782 missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84436866 missense probably damaging 1.00
R7749:Aldh6a1 UTSW 12 84442081 missense probably benign 0.00
R8511:Aldh6a1 UTSW 12 84433971 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCGCTCTGATGGTTTCATTAGGAAAG -3'
(R):5'- GCAATATTGGTCAGGTACTTTTGAGAC -3'

Sequencing Primer
(F):5'- GTATTTCCACAAACCATAGCCATG -3'
(R):5'- AGGACAAATCGCTGTCAG -3'
Posted On 2015-07-21