Incidental Mutation 'R4447:1700014D04Rik'
ID328811
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene NameRIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59740842-59746752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59742198 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 603 (T603A)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
Predicted Effect probably benign
Transcript: ENSMUST00000055343
AA Change: T185A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054
AA Change: T185A

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180139
AA Change: T603A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: T603A

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225577
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 unclassified probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATAGAATCAGACCCTGACCGAAC -3'
(R):5'- AAGCTCCGACCTTCTCCATG -3'

Sequencing Primer
(F):5'- AAACAGCTCCCTGGCCTTGAG -3'
(R):5'- GGAGACAAGATAGAAACCACAGACTC -3'
Posted On2015-07-21