Incidental Mutation 'R4447:Cyp11b2'
ID328812
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 2
SynonymsCyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4447 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74851010-74856318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74855563 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 90 (I90V)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
Predicted Effect probably benign
Transcript: ENSMUST00000167634
AA Change: I90V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: I90V

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Twsg1 C T 17: 65,929,787 D83N possibly damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
Spargel UTSW 15 74851432 missense probably damaging 1.00
stickfigure UTSW 15 74851570 missense possibly damaging 0.46
Stringbean UTSW 15 74853130 missense probably damaging 1.00
veronica UTSW 15 74853991 missense probably damaging 1.00
PIT4243001:Cyp11b2 UTSW 15 74851453 missense probably damaging 1.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R0837:Cyp11b2 UTSW 15 74853641 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1423:Cyp11b2 UTSW 15 74853130 missense probably damaging 1.00
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3437:Cyp11b2 UTSW 15 74855449 missense probably benign
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R5775:Cyp11b2 UTSW 15 74853478 missense probably benign 0.02
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
R6997:Cyp11b2 UTSW 15 74851432 missense probably damaging 1.00
R7094:Cyp11b2 UTSW 15 74853658 missense possibly damaging 0.94
R7096:Cyp11b2 UTSW 15 74855988 missense probably damaging 0.98
R7275:Cyp11b2 UTSW 15 74853991 missense probably damaging 1.00
R7456:Cyp11b2 UTSW 15 74853530 missense probably benign 0.01
R7604:Cyp11b2 UTSW 15 74853750 splice site probably null
R8002:Cyp11b2 UTSW 15 74856032 missense probably damaging 1.00
R8222:Cyp11b2 UTSW 15 74856210 missense probably benign 0.03
R8346:Cyp11b2 UTSW 15 74851768 missense probably damaging 1.00
R8349:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8449:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCTGGGTCATCAATCTCAAC -3'
(R):5'- CTCACTGCTGAGAGGATAGAGTG -3'

Sequencing Primer
(F):5'- GGGTCATCAATCTCAACTCTCTC -3'
(R):5'- CTGCTGAGAGGATAGAGTGTGTGG -3'
Posted On2015-07-21