Incidental Mutation 'R4447:Twsg1'
ID 328814
Institutional Source Beutler Lab
Gene Symbol Twsg1
Ensembl Gene ENSMUSG00000024098
Gene Name twisted gastrulation BMP signaling modulator 1
Synonyms 1810013J15Rik, D17Ertd403e, 9030422N06Rik, Tsg
MMRRC Submission 041708-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R4447 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 65923066-65951187 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65929787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 83 (D83N)
Ref Sequence ENSEMBL: ENSMUSP00000024906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024906]
AlphaFold Q9EP52
Predicted Effect possibly damaging
Transcript: ENSMUST00000024906
AA Change: D83N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024906
Gene: ENSMUSG00000024098
AA Change: D83N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tsg 85 221 3.6e-49 PFAM
Meta Mutation Damage Score 0.1169 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous null mice appear healthy at birth, but more than half of the progeny fail to thrive and exhibit dwarfism with delayed ossification and immune system. These defects result in premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsf2 G T 11: 94,569,359 P389Q possibly damaging Het
Aldh6a1 A G 12: 84,439,709 V120A possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ankar A G 1: 72,687,789 S415P possibly damaging Het
Ano3 A T 2: 110,761,578 probably null Het
Asic4 A T 1: 75,470,370 probably benign Het
Atp1a4 A C 1: 172,234,431 I709S probably damaging Het
Cyp11b2 T C 15: 74,855,563 I90V probably benign Het
Fam129a A T 1: 151,636,402 probably null Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Irf5 T A 6: 29,535,942 D318E probably damaging Het
Map2k3 A T 11: 60,947,171 S253C probably damaging Het
Mgst1 G T 6: 138,141,664 probably benign Het
Mipol1 G T 12: 57,352,748 probably benign Het
Olfr371 T A 8: 85,231,366 Y290* probably null Het
Pomgnt1 G T 4: 116,152,923 V161L possibly damaging Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Rxfp1 C T 3: 79,652,127 probably benign Het
Scn5a T C 9: 119,550,627 D197G probably damaging Het
Thsd7a G A 6: 12,324,635 T1479I probably damaging Het
Ubqln3 C T 7: 104,142,814 R23Q probably benign Het
Vmn1r228 T C 17: 20,777,107 I50V probably damaging Het
Wnk4 T A 11: 101,268,451 S565T possibly damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Zfp407 A T 18: 84,562,694 V98D possibly damaging Het
Zfp598 T A 17: 24,676,555 V73E probably damaging Het
Zscan29 T A 2: 121,169,886 probably null Het
Other mutations in Twsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Twsg1 APN 17 65948651 splice site probably benign
IGL01313:Twsg1 APN 17 65948704 missense probably damaging 1.00
IGL01752:Twsg1 APN 17 65929784 missense probably benign 0.04
IGL02326:Twsg1 APN 17 65926436 missense possibly damaging 0.75
PIT4791001:Twsg1 UTSW 17 65929711 missense probably benign 0.03
R3983:Twsg1 UTSW 17 65929763 missense probably benign 0.20
R4328:Twsg1 UTSW 17 65948738 missense probably benign
R4449:Twsg1 UTSW 17 65926310 missense possibly damaging 0.88
R4625:Twsg1 UTSW 17 65929551 missense probably benign 0.00
R6597:Twsg1 UTSW 17 65937804 missense probably damaging 0.99
R7265:Twsg1 UTSW 17 65929787 missense possibly damaging 0.58
R8677:Twsg1 UTSW 17 65926407 missense probably damaging 0.99
R8891:Twsg1 UTSW 17 65948662 missense
R9273:Twsg1 UTSW 17 65926311 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGACACGTTTTGGTGGTGC -3'
(R):5'- TCTGTGTTGCCAAAGCCTTG -3'

Sequencing Primer
(F):5'- TGGTGCAGCTGGTTCAC -3'
(R):5'- TAGCAGAATCCAGCAGTG -3'
Posted On 2015-07-21