Incidental Mutation 'R4448:Lmo2'
ID328821
Institutional Source Beutler Lab
Gene Symbol Lmo2
Ensembl Gene ENSMUSG00000032698
Gene NameLIM domain only 2
SynonymsRbtn2, Rhom-2, Rbtn-2
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103957986-103981878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103981062 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 147 (Y147H)
Ref Sequence ENSEMBL: ENSMUSP00000106769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111139] [ENSMUST00000111140] [ENSMUST00000111143] [ENSMUST00000123437] [ENSMUST00000138815] [ENSMUST00000156813] [ENSMUST00000170926]
Predicted Effect probably damaging
Transcript: ENSMUST00000111139
AA Change: Y147H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106769
Gene: ENSMUSG00000032698
AA Change: Y147H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 91 145 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111140
AA Change: Y219H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106770
Gene: ENSMUSG00000032698
AA Change: Y219H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 99 153 4.03e-10 SMART
LIM 163 217 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111143
AA Change: Y211H

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106773
Gene: ENSMUSG00000032698
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
LIM 91 145 4.03e-10 SMART
LIM 155 209 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123437
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117703
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133210
Predicted Effect probably benign
Transcript: ENSMUST00000138815
SMART Domains Protein: ENSMUSP00000121927
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
Pfam:LIM 30 59 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156813
SMART Domains Protein: ENSMUSP00000122369
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 144 1.36e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170926
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128317
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lack of yolk sac erythropoiesis and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Lmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Lmo2 APN 2 103981087 missense probably benign 0.21
R1983:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2013:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2014:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2131:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2132:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2133:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2233:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2235:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2510:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3038:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3813:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4058:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4059:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4450:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4544:Lmo2 UTSW 2 103976037 missense probably damaging 1.00
R4805:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4808:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4975:Lmo2 UTSW 2 103976143 nonsense probably null
R5310:Lmo2 UTSW 2 103976100 missense probably damaging 0.98
R5823:Lmo2 UTSW 2 103981072 missense probably damaging 1.00
R6267:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6296:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6949:Lmo2 UTSW 2 103970673 start codon destroyed probably null 0.53
R8051:Lmo2 UTSW 2 103970700 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGCATCCTGTGACAAGC -3'
(R):5'- TTCTCTCTAAGGGCTGGTCC -3'

Sequencing Primer
(F):5'- ATCCTGTGACAAGCGGATC -3'
(R):5'- GAAGTCTCAGCCTTTGCATTATG -3'
Posted On2015-07-21