Incidental Mutation 'R4448:Pag1'
ID328825
Institutional Source Beutler Lab
Gene Symbol Pag1
Ensembl Gene ENSMUSG00000027508
Gene Namephosphoprotein associated with glycosphingolipid microdomains 1
SynonymsF730007C19Rik, Cbp
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location9687479-9833679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9699466 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 209 (E209G)
Ref Sequence ENSEMBL: ENSMUSP00000124529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108384] [ENSMUST00000161949]
Predicted Effect probably benign
Transcript: ENSMUST00000108384
AA Change: E209G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104021
Gene: ENSMUSG00000027508
AA Change: E209G

DomainStartEndE-ValueType
Pfam:PAG 1 429 8.7e-209 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159825
Predicted Effect probably benign
Transcript: ENSMUST00000161949
AA Change: E209G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124529
Gene: ENSMUSG00000027508
AA Change: E209G

DomainStartEndE-ValueType
Pfam:PAG 2 429 1.4e-208 PFAM
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type III transmembrane adaptor protein that binds to the tyrosine kinase csk protein. It is thought to be involved in the regulation of T cell activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no apparent defects in embryogenesis, thymic development, or T-cell functions. Mice homozygous for a different knock-out allele show normal T-cell development albeit with an increased thymocyte population. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Pag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Pag1 APN 3 9693826 missense probably damaging 0.97
R0331:Pag1 UTSW 3 9701970 missense probably benign 0.13
R0561:Pag1 UTSW 3 9699421 missense probably damaging 1.00
R1797:Pag1 UTSW 3 9693886 missense probably benign 0.04
R2082:Pag1 UTSW 3 9699485 missense probably damaging 0.96
R2315:Pag1 UTSW 3 9699764 missense probably damaging 1.00
R3772:Pag1 UTSW 3 9699628 missense probably benign 0.20
R5590:Pag1 UTSW 3 9699422 missense probably damaging 1.00
R6157:Pag1 UTSW 3 9693836 missense probably benign 0.00
R6481:Pag1 UTSW 3 9699336 missense possibly damaging 0.85
R6776:Pag1 UTSW 3 9699788 missense probably benign 0.29
R7450:Pag1 UTSW 3 9699539 missense probably damaging 1.00
R7574:Pag1 UTSW 3 9693891 missense probably damaging 1.00
R8046:Pag1 UTSW 3 9699422 missense probably damaging 1.00
Z1177:Pag1 UTSW 3 9696138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTCAGCATGACCCAAG -3'
(R):5'- CGTGGACGAGATTCTCACAG -3'

Sequencing Primer
(F):5'- AAGCCCACCTTGCTGTG -3'
(R):5'- GACGAGATTCTCACAGCCAGG -3'
Posted On2015-07-21