Incidental Mutation 'R4448:Gpr4'
ID328831
Institutional Source Beutler Lab
Gene Symbol Gpr4
Ensembl Gene ENSMUSG00000044317
Gene NameG protein-coupled receptor 4
Synonyms
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19212538-19224174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19223001 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 283 (A283T)
Ref Sequence ENSEMBL: ENSMUSP00000061243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060225]
Predicted Effect probably damaging
Transcript: ENSMUST00000060225
AA Change: A283T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061243
Gene: ENSMUSG00000044317
AA Change: A283T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 27 302 2.8e-6 PFAM
Pfam:7tm_1 36 288 2.9e-39 PFAM
low complexity region 330 341 N/A INTRINSIC
Meta Mutation Damage Score 0.6875 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial neonatal and postnatal lethality, hemorrhages, impaired association of vascular smooth muscle cells with capillaries and small arteries and veins, and impaired contact between mesangial cells and renal glomerular capillaries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Gpr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1628:Gpr4 UTSW 7 19223199 missense probably benign
R1878:Gpr4 UTSW 7 19223124 missense probably damaging 1.00
R2094:Gpr4 UTSW 7 19222578 missense possibly damaging 0.58
R2117:Gpr4 UTSW 7 19223145 missense probably damaging 0.98
R4705:Gpr4 UTSW 7 19222894 missense probably damaging 1.00
R6815:Gpr4 UTSW 7 19222635 missense probably damaging 0.98
R7191:Gpr4 UTSW 7 19223230 missense probably benign
R7196:Gpr4 UTSW 7 19223164 missense probably benign 0.10
R7733:Gpr4 UTSW 7 19222710 missense probably damaging 1.00
R7752:Gpr4 UTSW 7 19222415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCAAACGTCTGGCCCTG -3'
(R):5'- CAGGATGACAGTTGGGCATG -3'

Sequencing Primer
(F):5'- GAGCCTCATCGCCATTGTG -3'
(R):5'- ACCTTCAGTGGCACCTGGTC -3'
Posted On2015-07-21