Incidental Mutation 'R4448:Alg11'
ID328837
Institutional Source Beutler Lab
Gene Symbol Alg11
Ensembl Gene ENSMUSG00000063362
Gene Nameasparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Synonyms
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22060721-22071627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22068079 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 469 (A469E)
Ref Sequence ENSEMBL: ENSMUSP00000072382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072572] [ENSMUST00000110737]
Predicted Effect probably benign
Transcript: ENSMUST00000072572
AA Change: A469E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072382
Gene: ENSMUSG00000063362
AA Change: A469E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:ALG11_N 62 269 2.6e-94 PFAM
Pfam:Glycos_transf_1 293 470 1.4e-30 PFAM
Pfam:Glyco_trans_1_4 301 454 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110737
AA Change: A427E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106365
Gene: ENSMUSG00000063362
AA Change: A427E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
Pfam:Glycos_transf_1 248 428 3.8e-29 PFAM
Pfam:Glyco_trans_1_4 259 412 7.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131624
SMART Domains Protein: ENSMUSP00000119161
Gene: ENSMUSG00000063362

DomainStartEndE-ValueType
Pfam:ALG11_N 4 160 1.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134474
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Alg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Alg11 APN 8 22061983 missense probably benign 0.22
1mM(1):Alg11 UTSW 8 22074057 missense probably benign
R0240:Alg11 UTSW 8 22065452 missense possibly damaging 0.83
R1908:Alg11 UTSW 8 22065568 missense probably damaging 1.00
R1980:Alg11 UTSW 8 22061887 missense possibly damaging 0.69
R2090:Alg11 UTSW 8 22065630 missense possibly damaging 0.80
R2147:Alg11 UTSW 8 22065293 missense probably damaging 1.00
R2159:Alg11 UTSW 8 22065845 missense probably benign 0.44
R2265:Alg11 UTSW 8 22065614 missense probably benign
R2760:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2761:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2762:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2763:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2764:Alg11 UTSW 8 22068079 missense probably benign 0.00
R2877:Alg11 UTSW 8 22065358 missense possibly damaging 0.93
R4165:Alg11 UTSW 8 22065557 missense probably damaging 1.00
R4230:Alg11 UTSW 8 22065518 missense probably damaging 1.00
R4370:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4371:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4447:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4450:Alg11 UTSW 8 22068079 missense probably benign 0.00
R4840:Alg11 UTSW 8 22068010 missense possibly damaging 0.91
R5859:Alg11 UTSW 8 22065841 missense probably benign 0.10
R5988:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7293:Alg11 UTSW 8 22065379 missense probably damaging 1.00
R7417:Alg11 UTSW 8 22062028 missense probably benign 0.00
R7610:Alg11 UTSW 8 22065131 missense probably damaging 1.00
X0019:Alg11 UTSW 8 22065424 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCCTTGCACACAACTCAGG -3'
(R):5'- AGAATGTTGCTCAGGCTGC -3'

Sequencing Primer
(F):5'- CAACTCAGGAGGCCCGAAG -3'
(R):5'- CTCAGGCTGCTTTGATTATGATAAAG -3'
Posted On2015-07-21