Incidental Mutation 'R4448:Atp6v1b2'
ID328839
Institutional Source Beutler Lab
Gene Symbol Atp6v1b2
Ensembl Gene ENSMUSG00000006273
Gene NameATPase, H+ transporting, lysosomal V1 subunit B2
SynonymsAtp6b2, HO57
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69088646-69113711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69102022 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 126 (D126E)
Ref Sequence ENSEMBL: ENSMUSP00000006435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006435]
Predicted Effect probably benign
Transcript: ENSMUST00000006435
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006435
Gene: ENSMUSG00000006273
AA Change: D126E

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 50 116 3.2e-14 PFAM
Pfam:ATP-synt_ab 173 399 1.9e-69 PFAM
Pfam:ATP-synt_ab_C 416 510 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153680
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Atp6v1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp6v1b2 APN 8 69088934 splice site probably null
IGL00908:Atp6v1b2 APN 8 69096266 missense probably benign 0.00
IGL01914:Atp6v1b2 APN 8 69096280 splice site probably benign
IGL03010:Atp6v1b2 APN 8 69105882 missense probably damaging 0.97
IGL03376:Atp6v1b2 APN 8 69102159 splice site probably benign
R0127:Atp6v1b2 UTSW 8 69103460 missense probably damaging 1.00
R0427:Atp6v1b2 UTSW 8 69101432 missense probably damaging 1.00
R0523:Atp6v1b2 UTSW 8 69109985 missense possibly damaging 0.52
R1754:Atp6v1b2 UTSW 8 69101961 missense probably benign 0.25
R1932:Atp6v1b2 UTSW 8 69102807 nonsense probably null
R1954:Atp6v1b2 UTSW 8 69105903 missense possibly damaging 0.95
R2228:Atp6v1b2 UTSW 8 69102759 splice site probably null
R2229:Atp6v1b2 UTSW 8 69102759 splice site probably null
R4738:Atp6v1b2 UTSW 8 69103410 missense probably benign
R5243:Atp6v1b2 UTSW 8 69103739 missense probably benign 0.07
R5388:Atp6v1b2 UTSW 8 69101437 missense probably benign 0.00
R5664:Atp6v1b2 UTSW 8 69107620 missense probably damaging 0.99
R5774:Atp6v1b2 UTSW 8 69101961 missense probably damaging 0.97
R5894:Atp6v1b2 UTSW 8 69107566 intron probably null
R6015:Atp6v1b2 UTSW 8 69102496 missense probably damaging 1.00
R6147:Atp6v1b2 UTSW 8 69102482 nonsense probably null
R6217:Atp6v1b2 UTSW 8 69109878 critical splice acceptor site probably null
R6636:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R6637:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R7032:Atp6v1b2 UTSW 8 69088896 missense probably benign 0.44
R7108:Atp6v1b2 UTSW 8 69102501 missense probably damaging 1.00
R7184:Atp6v1b2 UTSW 8 69102567 missense possibly damaging 0.55
R7578:Atp6v1b2 UTSW 8 69103476 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCTCCTTGGGATGTTTGAC -3'
(R):5'- AGGAAGTCTTCAGCCAGCAC -3'

Sequencing Primer
(F):5'- ATGTTTGACCCTGCAAGCAG -3'
(R):5'- ACAGGGCCTCGGTCAATG -3'
Posted On2015-07-21