Incidental Mutation 'R4448:Iqcm'
ID328840
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene NameIQ motif containing M
Synonyms1700007B14Rik
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75448694-75984503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75629766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 176 (S176P)
Ref Sequence ENSEMBL: ENSMUSP00000148495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
Predicted Effect probably damaging
Transcript: ENSMUST00000034033
AA Change: S176P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: S176P

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121983
AA Change: S176P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: S176P

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212704
AA Change: S176P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.3094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3804:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATATTCCTGCTGTTTACCCACAC -3'
(R):5'- CTTACTAGTCGTCCCCGAAATC -3'

Sequencing Primer
(F):5'- TGAGGATGCCACAGCTCTAGTTC -3'
(R):5'- GAAATCTCTTTTCTCTTTTGACACAG -3'
Posted On2015-07-21