Incidental Mutation 'R4448:Ctcf'
ID328842
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene NameCCCTC-binding factor
Synonyms
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105636568-105682922 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 105680293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841]
Predicted Effect probably benign
Transcript: ENSMUST00000005841
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156436
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 105677336 missense unknown
IGL01068:Ctcf APN 8 105681485 unclassified probably benign
IGL01936:Ctcf APN 8 105670232 missense probably benign 0.21
IGL02010:Ctcf APN 8 105664965 missense probably damaging 1.00
IGL02545:Ctcf APN 8 105664381 missense probably benign 0.39
IGL02617:Ctcf APN 8 105677210 splice site probably benign
R0255:Ctcf UTSW 8 105664039 missense possibly damaging 0.76
R0348:Ctcf UTSW 8 105676157 nonsense probably null
R0497:Ctcf UTSW 8 105675040 splice site probably benign
R1238:Ctcf UTSW 8 105671277 splice site probably benign
R1903:Ctcf UTSW 8 105675988 splice site probably null
R2508:Ctcf UTSW 8 105671384 missense probably damaging 1.00
R4035:Ctcf UTSW 8 105664157 missense possibly damaging 0.52
R5106:Ctcf UTSW 8 105681498 unclassified probably benign
R6370:Ctcf UTSW 8 105664220 missense probably benign 0.05
R6378:Ctcf UTSW 8 105663791 missense possibly damaging 0.70
R6392:Ctcf UTSW 8 105664133 missense probably damaging 0.97
R6737:Ctcf UTSW 8 105664508 missense probably benign 0.02
R7725:Ctcf UTSW 8 105663836 missense probably damaging 1.00
R7791:Ctcf UTSW 8 105664939 missense possibly damaging 0.47
R7895:Ctcf UTSW 8 105664058 missense possibly damaging 0.95
R7978:Ctcf UTSW 8 105664058 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGGAGCCTGCTGTAGAAATTG -3'
(R):5'- TAGAGACTGCCTCAGATGTTTCTC -3'

Sequencing Primer
(F):5'- CTGCTGTAGAAATTGAACCTGAGCC -3'
(R):5'- ACAAAACAGGGCTTCCTG -3'
Posted On2015-07-21