Incidental Mutation 'R4448:Galnt2'
ID328843
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Namepolypeptide N-acetylgalactosaminyltransferase 2
SynonymsppGaNTase-T2
MMRRC Submission 041709-MU
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124231391-124345724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124295377 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 14 (D14G)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000034458
AA Change: D48G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: D48G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
AA Change: D14G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: D14G

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147911
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
gallantry UTSW 8 124340822 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R7914:Galnt2 UTSW 8 124332078 missense probably benign 0.04
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGCGTAGTCTAGACGTCTCTGG -3'
(R):5'- GCAGTGTCCAGAAGCATAAGTC -3'

Sequencing Primer
(F):5'- CTAGACGTCTCTGGGTGATTATGAG -3'
(R):5'- GTGTCCAGAAGCATAAGTCATTCTC -3'
Posted On2015-07-21