Incidental Mutation 'R4448:Sqstm1'
ID328848
Institutional Source Beutler Lab
Gene Symbol Sqstm1
Ensembl Gene ENSMUSG00000015837
Gene Namesequestosome 1
SynonymsSTAP, OSF-6, p62, Osi, A170
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50199366-50210827 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 50203039 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015981] [ENSMUST00000020647] [ENSMUST00000102774] [ENSMUST00000136936] [ENSMUST00000143379]
Predicted Effect probably benign
Transcript: ENSMUST00000015981
SMART Domains Protein: ENSMUSP00000015981
Gene: ENSMUSG00000015837

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
UBA 358 397 9.33e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020647
Predicted Effect probably benign
Transcript: ENSMUST00000102774
SMART Domains Protein: ENSMUSP00000099835
Gene: ENSMUSG00000015837

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
UBA 396 435 9.33e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131214
Predicted Effect probably benign
Transcript: ENSMUST00000136936
SMART Domains Protein: ENSMUSP00000120442
Gene: ENSMUSG00000015837

DomainStartEndE-ValueType
UBA 63 102 9.33e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143379
SMART Domains Protein: ENSMUSP00000118662
Gene: ENSMUSG00000015837

DomainStartEndE-ValueType
PB1 3 102 1.96e-14 SMART
ZnF_ZZ 122 165 8.62e-19 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154805
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit impaired osteoclastogenesis in response to osteoclastogenic factors. Mice homozygous and heterozygous for a knock-in allele exhibit osteolytic lesion with increased bone formation, mineral apposition rate,and osteoclast numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Sqstm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1694:Sqstm1 UTSW 11 50207480 missense probably benign 0.00
R2099:Sqstm1 UTSW 11 50202984 missense possibly damaging 0.75
R5577:Sqstm1 UTSW 11 50207439 missense probably benign
R5586:Sqstm1 UTSW 11 50203022 missense probably damaging 1.00
R6042:Sqstm1 UTSW 11 50207424 missense probably benign 0.16
R6285:Sqstm1 UTSW 11 50202591 nonsense probably null
R7111:Sqstm1 UTSW 11 50202591 missense probably benign 0.01
R7702:Sqstm1 UTSW 11 50206105 critical splice acceptor site probably null
R8246:Sqstm1 UTSW 11 50210561 missense probably damaging 0.96
X0065:Sqstm1 UTSW 11 50200839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCAGAGACTGAGCAGG -3'
(R):5'- CACCTAGAGCTATGTGGTTCTG -3'

Sequencing Primer
(F):5'- AGACTGAGCAGGGCCCTC -3'
(R):5'- GTAAGTACACTGTAGCTGTCCTCAG -3'
Posted On2015-07-21