Incidental Mutation 'R4448:Efs'
ID328854
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Nameembryonal Fyn-associated substrate
Synonyms
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54916535-54926126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54920192 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 128 (S128P)
Ref Sequence ENSEMBL: ENSMUSP00000154657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000227037] [ENSMUST00000227587]
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: S221P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: S221P

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227037
AA Change: S128P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3431:Efs UTSW 14 54920224 missense probably damaging 1.00
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R4819:Efs UTSW 14 54917153 missense probably damaging 0.98
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 intron probably null
R6054:Efs UTSW 14 54921157 missense probably damaging 1.00
R7457:Efs UTSW 14 54919994 missense probably benign
R7822:Efs UTSW 14 54917450 missense probably benign 0.09
R8166:Efs UTSW 14 54920620 missense probably damaging 1.00
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCAGTGGATGGTAGCCTG -3'
(R):5'- GTCTATGATGTGCCTCCCAACATC -3'

Sequencing Primer
(F):5'- ATGGTAGCCTGGGCCTG -3'
(R):5'- AGCTGTCCCTATGACTCCCCAG -3'
Posted On2015-07-21