Incidental Mutation 'R4448:Hoxc12'
ID328858
Institutional Source Beutler Lab
Gene Symbol Hoxc12
Ensembl Gene ENSMUSG00000050328
Gene Namehomeobox C12
SynonymsHox-3.8
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102936757-102938609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102938476 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 268 (K268E)
Ref Sequence ENSEMBL: ENSMUSP00000051003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055562]
Predicted Effect probably damaging
Transcript: ENSMUST00000055562
AA Change: K268E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051003
Gene: ENSMUSG00000050328
AA Change: K268E

DomainStartEndE-ValueType
low complexity region 101 129 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
HOX 212 274 1.05e-20 SMART
Meta Mutation Damage Score 0.7826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Hoxc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Hoxc12 APN 15 102937320 missense probably benign
IGL01978:Hoxc12 APN 15 102936864 missense probably damaging 1.00
PIT4531001:Hoxc12 UTSW 15 102938420 missense probably damaging 1.00
R0724:Hoxc12 UTSW 15 102937055 missense probably damaging 0.99
R3748:Hoxc12 UTSW 15 102938378 missense probably damaging 1.00
R5151:Hoxc12 UTSW 15 102938446 missense probably damaging 1.00
R6376:Hoxc12 UTSW 15 102937089 missense possibly damaging 0.77
R7034:Hoxc12 UTSW 15 102938360 missense probably damaging 0.99
R7036:Hoxc12 UTSW 15 102938360 missense probably damaging 0.99
R7096:Hoxc12 UTSW 15 102937038 missense possibly damaging 0.79
R7295:Hoxc12 UTSW 15 102938375 missense probably damaging 0.97
X0028:Hoxc12 UTSW 15 102937458 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATCCTCTAGCCAACCCTG -3'
(R):5'- TTTCCCATAACCTCAGCGGG -3'

Sequencing Primer
(F):5'- TGGTACCCGATCCACAGC -3'
(R):5'- GCCTTCTCCGGCTAGGTTAG -3'
Posted On2015-07-21