Incidental Mutation 'R4448:Ezr'
ID328860
Institutional Source Beutler Lab
Gene Symbol Ezr
Ensembl Gene ENSMUSG00000052397
Gene Nameezrin
Synonymscytovillin, Vil2, ezrin, p81
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location6738041-6782784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6753074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 203 (I203V)
Ref Sequence ENSEMBL: ENSMUSP00000063734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234]
Predicted Effect probably benign
Transcript: ENSMUST00000064234
AA Change: I203V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397
AA Change: I203V

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality with abnormal intestinal villi morphology. Mice homozygous for a knock-down allele exhibit growth retardation, partial postnatal lethality, achlorhydria, and abnormal gastric parietal cell morphology and response to histamine stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Ezr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ezr APN 17 6742489 unclassified probably benign
IGL02871:Ezr APN 17 6742390 nonsense probably null
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0277:Ezr UTSW 17 6754765 nonsense probably null
R0323:Ezr UTSW 17 6754765 nonsense probably null
R0930:Ezr UTSW 17 6753999 nonsense probably null
R1497:Ezr UTSW 17 6742708 missense probably benign 0.07
R1669:Ezr UTSW 17 6739313 missense probably damaging 1.00
R1801:Ezr UTSW 17 6742372 missense possibly damaging 0.62
R2078:Ezr UTSW 17 6782642 start codon destroyed probably null 0.23
R4250:Ezr UTSW 17 6754797 missense probably damaging 1.00
R4610:Ezr UTSW 17 6739722 missense possibly damaging 0.71
R4691:Ezr UTSW 17 6759562 missense probably benign
R4736:Ezr UTSW 17 6741576 missense probably benign 0.42
R5327:Ezr UTSW 17 6753049 missense probably damaging 1.00
R6564:Ezr UTSW 17 6742847 missense probably damaging 0.99
R7863:Ezr UTSW 17 6741464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACTTCCAGGTCACCAC -3'
(R):5'- TACAGGGCTCAGGACAACAC -3'

Sequencing Primer
(F):5'- CTTCCAGGTCACCACTTAAGATGATG -3'
(R):5'- CATCCCGTATGCCGTGC -3'
Posted On2015-07-21