Incidental Mutation 'R4448:A1cf'
ID 328863
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms apobec-1 complementation factor, ACF, 1810073H04Rik
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4448 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 31868764-31948573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31945862 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 513 (T513S)
Ref Sequence ENSEMBL: ENSMUSP00000153542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304]
AlphaFold Q5YD48
Predicted Effect probably benign
Transcript: ENSMUST00000075838
AA Change: T521S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: T521S

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224304
AA Change: T513S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Fut7 A G 2: 25,424,939 T70A probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31920951 missense possibly damaging 0.90
IGL01411:A1cf APN 19 31911229 missense possibly damaging 0.94
IGL01445:A1cf APN 19 31945798 missense probably benign 0.32
IGL02165:A1cf APN 19 31927186 missense possibly damaging 0.92
IGL02543:A1cf APN 19 31918095 missense probably damaging 0.97
IGL02651:A1cf APN 19 31932506 missense probably benign 0.25
IGL02904:A1cf APN 19 31934806 missense probably damaging 1.00
Haywire UTSW 19 31918124 critical splice donor site probably null
R0281:A1cf UTSW 19 31945814 missense probably benign 0.09
R0349:A1cf UTSW 19 31932662 missense possibly damaging 0.62
R0662:A1cf UTSW 19 31920938 missense probably benign 0.00
R0697:A1cf UTSW 19 31911167 missense probably damaging 1.00
R1055:A1cf UTSW 19 31932519 missense probably benign 0.05
R1125:A1cf UTSW 19 31920978 missense probably benign 0.00
R1448:A1cf UTSW 19 31908796 missense possibly damaging 0.88
R1554:A1cf UTSW 19 31908902 missense possibly damaging 0.66
R1616:A1cf UTSW 19 31934775 missense probably damaging 0.98
R1660:A1cf UTSW 19 31893107 nonsense probably null
R1719:A1cf UTSW 19 31927126 missense probably damaging 1.00
R2338:A1cf UTSW 19 31932545 missense probably benign
R2435:A1cf UTSW 19 31920894 missense probably benign 0.02
R2890:A1cf UTSW 19 31918017 missense probably benign 0.05
R3688:A1cf UTSW 19 31911169 missense probably damaging 1.00
R4007:A1cf UTSW 19 31918124 critical splice donor site probably null
R4208:A1cf UTSW 19 31932660 missense probably benign 0.00
R5072:A1cf UTSW 19 31917985 missense probably benign 0.18
R5491:A1cf UTSW 19 31918062 missense possibly damaging 0.57
R5636:A1cf UTSW 19 31944982 nonsense probably null
R5932:A1cf UTSW 19 31893118 missense possibly damaging 0.68
R7066:A1cf UTSW 19 31927114 missense probably damaging 0.99
R7211:A1cf UTSW 19 31927141 missense probably benign 0.23
R7413:A1cf UTSW 19 31918124 critical splice donor site probably null
R7545:A1cf UTSW 19 31934790 missense possibly damaging 0.80
R8020:A1cf UTSW 19 31893194 missense probably benign 0.01
R8344:A1cf UTSW 19 31911119 missense possibly damaging 0.77
R8497:A1cf UTSW 19 31945850 missense probably benign
R8989:A1cf UTSW 19 31927156 missense possibly damaging 0.56
R9327:A1cf UTSW 19 31918099 missense probably benign 0.12
R9436:A1cf UTSW 19 31932575 missense probably benign
Z1176:A1cf UTSW 19 31918017 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACCGAGGTGCTGGATCAATG -3'
(R):5'- GCATGTAGTTGAGGGTTCTACAAAG -3'

Sequencing Primer
(F):5'- TGCACAAATATGCCTGCGTAG -3'
(R):5'- GTTCTACAAAGAAGCTCTCCCC -3'
Posted On 2015-07-21