Mutagenetix > Incidental Mutation

Incidental Mutation 'R4448:A1cf'

328863

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

041709-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R4448 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31945862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 513 (T513S)

Ref Sequence

ENSEMBL: ENSMUSP00000153542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304]

AlphaFold

Q5YD48

Predicted Effect

probably benign
Transcript: ENSMUST00000075838
AA Change: T521S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: T521S

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224304
AA Change: T513S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

94% (49/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acaca	A	T	11: 84,262,492	I909F	probably damaging	Het
Adgb	T	C	10: 10,390,825	I980V	probably benign	Het
Akap13	T	A	7: 75,742,760	F2450L	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Asb8	A	G	15: 98,141,330	V63A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,102,022	D126E	probably benign	Het
BC048562	T	A	9: 108,438,524	L43Q	probably damaging	Het
Ctcf	A	T	8: 105,680,293		probably benign	Het
Efs	A	G	14: 54,920,192	S128P	probably damaging	Het
Epg5	T	A	18: 77,962,461	M722K	probably damaging	Het
Ezr	T	C	17: 6,753,074	I203V	probably benign	Het
F5	A	T	1: 164,198,899	N1680I	possibly damaging	Het
Fcna	A	G	2: 25,625,476	F194L	probably damaging	Het
Fut7	A	G	2: 25,424,939	T70A	probably benign	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm13128	A	C	4: 144,332,685	H322P	probably damaging	Het
Gpr4	G	A	7: 19,223,001	A283T	probably damaging	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hhip	C	T	8: 80,043,945		probably null	Het
Hoxc12	A	G	15: 102,938,476	K268E	probably damaging	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Kansl1l	A	G	1: 66,738,159	S605P	probably damaging	Het
Kcnh4	A	G	11: 100,755,907	F198L	probably benign	Het
Kmt2e	T	C	5: 23,464,790	F92L	possibly damaging	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Mycbp2	T	C	14: 103,188,502	I2396V	possibly damaging	Het
Nckap5	G	A	1: 126,025,726	Q1030*	probably null	Het
Pag1	T	C	3: 9,699,466	E209G	probably benign	Het
Pttg1	A	T	11: 43,424,690		probably benign	Het
Rab38	T	G	7: 88,490,625	D167E	probably benign	Het
Rbm26	A	T	14: 105,151,550	F302I	probably damaging	Het
Rpap2	G	A	5: 107,601,795	V62I	possibly damaging	Het
Sec23b	A	G	2: 144,559,251	N11D	probably benign	Het
Sipa1l1	G	A	12: 82,341,750	G250D	probably benign	Het
Sipa1l2	A	T	8: 125,492,355	V81D	probably damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Sqstm1	A	G	11: 50,203,039		probably benign	Het
Taf4	A	G	2: 179,935,971	L519P	possibly damaging	Het
Tdrd6	C	T	17: 43,629,735	G141S	probably benign	Het
Urb1	C	T	16: 90,769,394	V1502I	possibly damaging	Het
Vmn1r222	A	C	13: 23,232,293	V250G	probably benign	Het
Vmn1r222	G	A	13: 23,232,660	L128F	probably damaging	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ACCGAGGTGCTGGATCAATG -3'
(R):5'- GCATGTAGTTGAGGGTTCTACAAAG -3'

Sequencing Primer
(F):5'- TGCACAAATATGCCTGCGTAG -3'
(R):5'- GTTCTACAAAGAAGCTCTCCCC -3'

Posted On

2015-07-21