Incidental Mutation 'R4449:Ubr1'
ID328864
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120946381 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 293 (V293A)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028728
AA Change: V293A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: V293A

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133408
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 synonymous probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 intron probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGCCTGGCAAAATATCTGTC -3'
(R):5'- TCTAGGAGCCTAAGTAGAAAAGCC -3'

Sequencing Primer
(F):5'- GGCCTGGCAAAATATCTGTCTAAAG -3'
(R):5'- AAAGCCAAGTGAGGTTATTGTTGCC -3'
Posted On2015-07-21