Incidental Mutation 'R4449:Dap3'
ID328867
Institutional Source Beutler Lab
Gene Symbol Dap3
Ensembl Gene ENSMUSG00000068921
Gene Namedeath associated protein 3
SynonymsDAP-3, 4921514D13Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4449 (G1)
Quality Score130
Status Validated
Chromosome3
Chromosomal Location88920803-88951181 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 88949878 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090938] [ENSMUST00000107491] [ENSMUST00000172942] [ENSMUST00000173021] [ENSMUST00000173135] [ENSMUST00000174077] [ENSMUST00000174402] [ENSMUST00000186583]
Predicted Effect probably benign
Transcript: ENSMUST00000090938
SMART Domains Protein: ENSMUSP00000088456
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 97 392 2.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107491
SMART Domains Protein: ENSMUSP00000103115
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 97 306 1e-67 PFAM
Pfam:DAP3 300 362 6.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172790
Predicted Effect probably benign
Transcript: ENSMUST00000172942
SMART Domains Protein: ENSMUSP00000134145
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 63 133 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173021
SMART Domains Protein: ENSMUSP00000133314
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 200 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173135
SMART Domains Protein: ENSMUSP00000134422
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 387 8e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174077
SMART Domains Protein: ENSMUSP00000134433
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 212 7.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174402
SMART Domains Protein: ENSMUSP00000133395
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 79 165 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186583
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188259
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality with defects in mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Dap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Dap3 APN 3 88936228 missense probably benign 0.23
IGL02111:Dap3 APN 3 88929418 missense probably benign 0.26
IGL02453:Dap3 APN 3 88928327 missense probably benign 0.07
IGL02989:Dap3 APN 3 88930571 splice site probably benign
R0094:Dap3 UTSW 3 88927028 missense probably benign 0.01
R0665:Dap3 UTSW 3 88930997 nonsense probably null
R1853:Dap3 UTSW 3 88930926 missense probably damaging 1.00
R1885:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R1887:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R2351:Dap3 UTSW 3 88933563 critical splice donor site probably null
R2513:Dap3 UTSW 3 88928258 missense probably benign 0.15
R4749:Dap3 UTSW 3 88926310 missense probably benign 0.00
R5359:Dap3 UTSW 3 88930989 missense probably damaging 1.00
R5502:Dap3 UTSW 3 88925326 missense probably damaging 1.00
R6899:Dap3 UTSW 3 88933600 missense probably benign 0.01
R6919:Dap3 UTSW 3 88930989 missense probably damaging 0.98
R6946:Dap3 UTSW 3 88938216 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCATCACAGAGGATAGGTACCC -3'
(R):5'- CCGGAATGTTTTGAAGAGCGAG -3'

Sequencing Primer
(F):5'- CCTCTGGGACTTTAACAAGGTTAAAC -3'
(R):5'- CGAGCGAAGGTACCTAGGC -3'
Posted On2015-07-21