Incidental Mutation 'R4449:Pi4kb'
ID328868
Institutional Source Beutler Lab
Gene Symbol Pi4kb
Ensembl Gene ENSMUSG00000038861
Gene Namephosphatidylinositol 4-kinase beta
SynonymsESTM41, Pik4cb
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94974731-95006843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94984735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 254 (S254L)
Ref Sequence ENSEMBL: ENSMUSP00000121965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000138209] [ENSMUST00000167008]
Predicted Effect probably benign
Transcript: ENSMUST00000072287
AA Change: S242L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861
AA Change: S242L

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
AA Change: S242L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861
AA Change: S242L

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
AA Change: S254L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861
AA Change: S254L

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138209
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Meta Mutation Damage Score 0.1788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Pi4kb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Pi4kb APN 3 95004263 missense probably damaging 1.00
IGL01559:Pi4kb APN 3 94984129 missense probably benign 0.00
IGL03003:Pi4kb APN 3 94984812 missense probably benign 0.00
IGL03087:Pi4kb APN 3 94984764 missense probably benign
R0014:Pi4kb UTSW 3 94998897 missense probably damaging 1.00
R0196:Pi4kb UTSW 3 94998950 missense probably damaging 1.00
R0387:Pi4kb UTSW 3 94984740 missense probably benign 0.42
R0394:Pi4kb UTSW 3 94996804 intron probably benign
R0394:Pi4kb UTSW 3 94996805 intron probably benign
R1485:Pi4kb UTSW 3 94994387 missense probably damaging 0.99
R3700:Pi4kb UTSW 3 94994288 missense probably benign 0.09
R4502:Pi4kb UTSW 3 94996607 missense probably benign 0.02
R4717:Pi4kb UTSW 3 94998851 missense probably damaging 1.00
R4737:Pi4kb UTSW 3 95004338 missense probably damaging 1.00
R4763:Pi4kb UTSW 3 95004409 intron probably benign
R5322:Pi4kb UTSW 3 94994249 missense probably benign 0.04
R5427:Pi4kb UTSW 3 94994207 missense probably benign 0.09
R5622:Pi4kb UTSW 3 94998861 missense possibly damaging 0.56
R5625:Pi4kb UTSW 3 94984677 missense probably benign 0.15
R5755:Pi4kb UTSW 3 94994297 unclassified probably null
R5926:Pi4kb UTSW 3 94998996 missense probably damaging 1.00
R6904:Pi4kb UTSW 3 94993150 missense probably damaging 1.00
R6984:Pi4kb UTSW 3 94996934 missense probably damaging 1.00
R7221:Pi4kb UTSW 3 94994189 missense probably damaging 1.00
R7312:Pi4kb UTSW 3 94984577 missense probably benign 0.12
R7511:Pi4kb UTSW 3 94989312 missense probably benign 0.00
R7571:Pi4kb UTSW 3 94999114 critical splice donor site probably null
R7885:Pi4kb UTSW 3 94999076 missense probably damaging 1.00
R7968:Pi4kb UTSW 3 94999076 missense probably damaging 1.00
Z1088:Pi4kb UTSW 3 94984509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGCAATGAGGATGTGGAC -3'
(R):5'- TCTCCACTTTAGGGTTGCTG -3'

Sequencing Primer
(F):5'- GATGTGGACTTCTATTTGCCCCAG -3'
(R):5'- CACTTTAGGGTTGCTGGCTGTTC -3'
Posted On2015-07-21