Incidental Mutation 'R4449:Ttc39a'
ID328872
Institutional Source Beutler Lab
Gene Symbol Ttc39a
Ensembl Gene ENSMUSG00000028555
Gene Nametetratricopeptide repeat domain 39A
Synonyms4922503N01Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109406623-109444745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109442303 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 449 (I449T)
Ref Sequence ENSEMBL: ENSMUSP00000102229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064129] [ENSMUST00000106618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064129
AA Change: I447T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066334
Gene: ENSMUSG00000028555
AA Change: I447T

DomainStartEndE-ValueType
TPR 278 311 7.69e1 SMART
TPR 468 501 6.57e1 SMART
TPR 509 542 1.42e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106618
AA Change: I449T

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102229
Gene: ENSMUSG00000028555
AA Change: I449T

DomainStartEndE-ValueType
TPR 280 313 7.69e1 SMART
TPR 470 503 6.57e1 SMART
TPR 511 544 1.42e0 SMART
Meta Mutation Damage Score 0.2109 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Ttc39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Ttc39a APN 4 109442345 splice site probably benign
IGL01143:Ttc39a APN 4 109442813 critical splice donor site probably null
IGL01802:Ttc39a APN 4 109433084 nonsense probably null
IGL01906:Ttc39a APN 4 109421394 missense probably benign 0.04
IGL02115:Ttc39a APN 4 109426294 splice site probably benign
IGL02415:Ttc39a APN 4 109431529 unclassified probably benign
IGL02658:Ttc39a APN 4 109422893 missense probably damaging 1.00
IGL02728:Ttc39a APN 4 109442723 missense probably damaging 1.00
IGL03281:Ttc39a APN 4 109433022 missense possibly damaging 0.84
R0030:Ttc39a UTSW 4 109422973 missense probably benign
R0103:Ttc39a UTSW 4 109421453 intron probably null
R0194:Ttc39a UTSW 4 109444179 missense probably benign
R0561:Ttc39a UTSW 4 109440602 missense probably damaging 1.00
R0603:Ttc39a UTSW 4 109426302 missense probably damaging 1.00
R2132:Ttc39a UTSW 4 109442706 missense probably damaging 1.00
R2203:Ttc39a UTSW 4 109431588 missense probably benign 0.19
R2473:Ttc39a UTSW 4 109442239 missense probably damaging 0.97
R4809:Ttc39a UTSW 4 109416021 nonsense probably null
R5266:Ttc39a UTSW 4 109422504 missense probably benign 0.04
R5590:Ttc39a UTSW 4 109432987 critical splice acceptor site probably null
R5911:Ttc39a UTSW 4 109422971 missense possibly damaging 0.79
R5930:Ttc39a UTSW 4 109430878 missense probably benign
R7058:Ttc39a UTSW 4 109431566 missense probably damaging 1.00
R7771:Ttc39a UTSW 4 109431450 missense probably damaging 1.00
R7791:Ttc39a UTSW 4 109426347 missense probably benign 0.00
R7849:Ttc39a UTSW 4 109422490 missense probably benign 0.00
R7932:Ttc39a UTSW 4 109422490 missense probably benign 0.00
X0013:Ttc39a UTSW 4 109433137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTCAGGACCTTTTGAACTG -3'
(R):5'- TGCAAGTTACTCAGGGAGC -3'

Sequencing Primer
(F):5'- CAGGACCTTTTGAACTGAGCTGC -3'
(R):5'- GATTCACCTCAGGGGACTCAC -3'
Posted On2015-07-21