Incidental Mutation 'R4449:Skint3'
ID328873
Institutional Source Beutler Lab
Gene Symbol Skint3
Ensembl Gene ENSMUSG00000070868
Gene Nameselection and upkeep of intraepithelial T cells 3
Synonyms
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112232245-112300468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112270009 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 287 (V287E)
Ref Sequence ENSEMBL: ENSMUSP00000131300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038455] [ENSMUST00000170945]
Predicted Effect probably benign
Transcript: ENSMUST00000038455
SMART Domains Protein: ENSMUSP00000042662
Gene: ENSMUSG00000070868

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170945
AA Change: V287E

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131300
Gene: ENSMUSG00000070868
AA Change: V287E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 384 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Skint3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Skint3 APN 4 112255909 splice site probably benign
IGL01344:Skint3 APN 4 112290322 missense possibly damaging 0.53
IGL02875:Skint3 APN 4 112255882 missense possibly damaging 0.88
IGL03308:Skint3 APN 4 112254067 missense probably damaging 1.00
IGL03372:Skint3 APN 4 112255906 splice site probably benign
R0043:Skint3 UTSW 4 112277623 missense probably damaging 0.98
R0671:Skint3 UTSW 4 112255777 nonsense probably null
R0747:Skint3 UTSW 4 112253905 missense probably damaging 1.00
R1191:Skint3 UTSW 4 112235742 start codon destroyed probably null 0.95
R2058:Skint3 UTSW 4 112255783 nonsense probably null
R3819:Skint3 UTSW 4 112255888 missense possibly damaging 0.68
R3893:Skint3 UTSW 4 112253918 missense probably damaging 0.97
R4166:Skint3 UTSW 4 112255635 missense possibly damaging 0.89
R4662:Skint3 UTSW 4 112277666 nonsense probably null
R4790:Skint3 UTSW 4 112255898 missense possibly damaging 0.49
R5374:Skint3 UTSW 4 112298189 missense possibly damaging 0.81
R5570:Skint3 UTSW 4 112235798 missense probably benign 0.08
R6024:Skint3 UTSW 4 112290346 missense possibly damaging 0.66
R6306:Skint3 UTSW 4 112255875 missense probably damaging 1.00
R6552:Skint3 UTSW 4 112290285 missense possibly damaging 0.95
R6619:Skint3 UTSW 4 112253864 missense probably damaging 1.00
R6972:Skint3 UTSW 4 112258892 missense probably damaging 0.98
Z1176:Skint3 UTSW 4 112253902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACATTTGTGCCATCCACTA -3'
(R):5'- GGGTTGAAGCTTTCCCTACCA -3'

Sequencing Primer
(F):5'- AAGTGTATCTGGGCCACGATC -3'
(R):5'- AGAGACAATTCCCCCTCTGTG -3'
Posted On2015-07-21