Incidental Mutation 'R4449:Luzp1'
ID328874
Institutional Source Beutler Lab
Gene Symbol Luzp1
Ensembl Gene ENSMUSG00000001089
Gene Nameleucine zipper protein 1
SynonymsLuzp, 2700072H04Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136469761-136554780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136540863 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 132 (N132K)
Ref Sequence ENSEMBL: ENSMUSP00000130758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000063021] [ENSMUST00000105849] [ENSMUST00000129230] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably damaging
Transcript: ENSMUST00000001116
AA Change: N132K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089
AA Change: N132K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000063021
AA Change: N132K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060619
Gene: ENSMUSG00000001089
AA Change: N132K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000105849
AA Change: N132K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089
AA Change: N132K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000129230
SMART Domains Protein: ENSMUSP00000128591
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
coiled coil region 11 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably damaging
Transcript: ENSMUST00000170102
AA Change: N132K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089
AA Change: N132K

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Gene inactivation causes defective neural tube closure (exencephaly) and massive apoptosis in the hindbrain. Despite the incomplete penetrance of NTD, all homozygotes die perinatally due to complex cardiovascular anomalies. Other defects include an eyelid fusion defect, omphalocele and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Luzp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Luzp1 APN 4 136542776 missense probably damaging 1.00
IGL01766:Luzp1 APN 4 136542773 missense possibly damaging 0.92
IGL01868:Luzp1 APN 4 136542737 missense probably damaging 1.00
IGL03230:Luzp1 APN 4 136542878 missense probably benign 0.02
FR4548:Luzp1 UTSW 4 136543188 small insertion probably benign
FR4737:Luzp1 UTSW 4 136543196 small insertion probably benign
R0106:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R0674:Luzp1 UTSW 4 136543457 missense possibly damaging 0.85
R0676:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R1103:Luzp1 UTSW 4 136540730 missense possibly damaging 0.87
R1541:Luzp1 UTSW 4 136543325 missense probably damaging 1.00
R1812:Luzp1 UTSW 4 136542331 missense probably benign 0.03
R3924:Luzp1 UTSW 4 136542857 missense probably damaging 1.00
R4022:Luzp1 UTSW 4 136542193 missense probably benign 0.02
R4976:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5119:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5411:Luzp1 UTSW 4 136543342 missense possibly damaging 0.59
R5659:Luzp1 UTSW 4 136542476 missense probably damaging 1.00
R5765:Luzp1 UTSW 4 136541029 missense probably damaging 0.98
R5828:Luzp1 UTSW 4 136540682 missense probably damaging 1.00
R6059:Luzp1 UTSW 4 136541480 missense probably benign 0.35
R6147:Luzp1 UTSW 4 136541063 missense probably damaging 1.00
R6181:Luzp1 UTSW 4 136543267 missense probably benign 0.01
R6200:Luzp1 UTSW 4 136541266 missense probably benign 0.12
R6368:Luzp1 UTSW 4 136541780 missense probably benign 0.24
R6581:Luzp1 UTSW 4 136540631 missense probably damaging 1.00
R6695:Luzp1 UTSW 4 136545298 missense possibly damaging 0.83
R6932:Luzp1 UTSW 4 136540813 nonsense probably null
R6998:Luzp1 UTSW 4 136543444 missense probably damaging 1.00
R7529:Luzp1 UTSW 4 136540932 missense probably damaging 1.00
R7878:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R7961:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R8077:Luzp1 UTSW 4 136543091 missense probably damaging 1.00
R8154:Luzp1 UTSW 4 136541884 missense possibly damaging 0.47
R8292:Luzp1 UTSW 4 136542453 missense probably benign 0.01
RF028:Luzp1 UTSW 4 136543196 small insertion probably benign
RF033:Luzp1 UTSW 4 136543196 small insertion probably benign
RF040:Luzp1 UTSW 4 136543196 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGGACAAGGTGATCCAG -3'
(R):5'- TTTCTCTCATTTACAAAGCTCAGGG -3'

Sequencing Primer
(F):5'- CCAGCGGGTACTGAAGATTG -3'
(R):5'- CAAAGCTCAGGGTTAATGATTTTAGC -3'
Posted On2015-07-21