Mutagenetix > Incidental Mutation

Incidental Mutation 'R4449:Sema3c'

328875

Institutional Source

Beutler Lab

Gene Symbol

Sema3c

Ensembl Gene

ENSMUSG00000028780

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

Synonyms

1110036B02Rik, Semae

MMRRC Submission

041710-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4449 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17574281-17730268 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to G at 17576846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030568] [ENSMUST00000169603] [ENSMUST00000170181]

AlphaFold

Q62181

Predicted Effect

probably benign
Transcript: ENSMUST00000030568

SMART Domains

Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Sema	54	495	1.16e-200	SMART
PSI	513	565	2.87e-13	SMART
IG	577	662	7.08e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169603

SMART Domains

Protein: ENSMUSP00000132330
Gene: ENSMUSG00000028780

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Sema	54	226	9.6e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170348

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgap3	A	T	15: 83,334,558	Y105N	probably damaging	Het
Arid3b	T	A	9: 57,798,121	K266*	probably null	Het
Bend3	A	G	10: 43,512,083	E824G	possibly damaging	Het
Bpifb6	A	G	2: 153,906,768	E228G	possibly damaging	Het
Cadm1	T	A	9: 47,813,988		probably benign	Het
Cadm1	C	T	9: 47,530,437	A22V	possibly damaging	Het
Cntrob	C	A	11: 69,305,549	D687Y	probably benign	Het
Dap3	A	T	3: 88,949,878		probably benign	Het
Ddc	T	C	11: 11,835,802	D295G	probably damaging	Het
Fut10	T	A	8: 31,236,257	Y347N	probably damaging	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Helz	T	C	11: 107,604,163	V321A	probably benign	Het
Hnrnpul1	T	C	7: 25,722,284		probably benign	Het
Hsdl2	T	A	4: 59,617,692	I353K	possibly damaging	Het
Igkv3-2	G	A	6: 70,698,841	A45T	probably benign	Het
Kcnh6	A	G	11: 106,018,936	Y429C	probably damaging	Het
Luzp1	T	A	4: 136,540,863	N132K	probably damaging	Het
Mlycd	T	A	8: 119,410,405	Y455N	probably damaging	Het
Myl7	C	T	11: 5,897,354	D115N	probably damaging	Het
Olfr593	A	T	7: 103,212,480	I196F	probably benign	Het
Pcdh7	A	G	5: 57,720,485	T461A	probably damaging	Het
Pi4kb	C	T	3: 94,984,735	S254L	probably benign	Het
Pitpnc1	A	G	11: 107,216,709	V257A	probably benign	Het
Prpf40b	A	G	15: 99,314,663	D596G	probably damaging	Het
Rngtt	T	C	4: 33,330,865	F156S	probably damaging	Het
Shisa6	T	C	11: 66,525,418	T183A	probably benign	Het
Skint3	T	A	4: 112,270,009	V287E	possibly damaging	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Slc17a3	A	T	13: 23,856,732	S392C	probably damaging	Het
Snx14	T	C	9: 88,422,999	I81V	probably benign	Het
Tdrd6	C	T	17: 43,629,735	G141S	probably benign	Het
Trappc12	A	T	12: 28,747,235	D99E	probably benign	Het
Trim34b	T	C	7: 104,335,728	C318R	probably benign	Het
Ttc39a	T	C	4: 109,442,303	I449T	possibly damaging	Het
Twsg1	A	C	17: 65,926,310	V215G	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ubr1	A	G	2: 120,946,381	V293A	possibly damaging	Het
Unk	G	A	11: 116,053,634	G404S	probably damaging	Het
Virma	T	C	4: 11,498,828		probably null	Het
Vps13b	T	C	15: 35,876,793	V2864A	possibly damaging	Het
Wdfy4	T	A	14: 33,096,083	R1492W	probably damaging	Het
Zcchc3	G	C	2: 152,414,722	P19R	probably benign	Het

Other mutations in Sema3c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Sema3c	APN	5	17694860	missense	probably damaging	1.00
IGL01528:Sema3c	APN	5	17714415	missense	probably benign
IGL01618:Sema3c	APN	5	17672506	missense	probably damaging	1.00
IGL01730:Sema3c	APN	5	17711436	missense	probably benign	0.01
IGL01762:Sema3c	APN	5	17694851	missense	possibly damaging	0.81
IGL02049:Sema3c	APN	5	17721925	splice site	probably benign
IGL02249:Sema3c	APN	5	17662963	missense	probably damaging	1.00
IGL02657:Sema3c	APN	5	17576868	start codon destroyed	possibly damaging	0.71
IGL02657:Sema3c	APN	5	17662974	missense	probably damaging	1.00
IGL03213:Sema3c	APN	5	17694639	splice site	probably benign
PIT4651001:Sema3c	UTSW	5	17694733	missense	probably benign	0.37
R0031:Sema3c	UTSW	5	17694728	missense	probably damaging	1.00
R0558:Sema3c	UTSW	5	17714415	missense	probably benign	0.00
R0964:Sema3c	UTSW	5	17721909	missense	probably damaging	1.00
R1164:Sema3c	UTSW	5	17678314	missense	probably benign	0.40
R1351:Sema3c	UTSW	5	17678336	missense	possibly damaging	0.60
R1368:Sema3c	UTSW	5	17678332	missense	possibly damaging	0.96
R1480:Sema3c	UTSW	5	17682031	missense	possibly damaging	0.57
R1880:Sema3c	UTSW	5	17727466	nonsense	probably null
R1916:Sema3c	UTSW	5	17727401	missense	probably benign	0.06
R3934:Sema3c	UTSW	5	17681940	missense	probably damaging	0.97
R4284:Sema3c	UTSW	5	17678347	missense	probably benign	0.01
R4545:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4546:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4660:Sema3c	UTSW	5	17672513	missense	probably damaging	1.00
R4890:Sema3c	UTSW	5	17675159	missense	probably benign	0.00
R4937:Sema3c	UTSW	5	17694686	missense	probably benign	0.01
R5065:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5145:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5452:Sema3c	UTSW	5	17717070	critical splice donor site	probably null
R5586:Sema3c	UTSW	5	17711424	missense	probably damaging	0.99
R5811:Sema3c	UTSW	5	17675190	splice site	probably null
R5886:Sema3c	UTSW	5	17681986	missense	possibly damaging	0.90
R6120:Sema3c	UTSW	5	17727632	missense	probably benign	0.00
R6191:Sema3c	UTSW	5	17653806	missense	probably damaging	1.00
R6318:Sema3c	UTSW	5	17672432	missense	probably damaging	0.96
R6416:Sema3c	UTSW	5	17576961	missense	probably damaging	0.99
R6441:Sema3c	UTSW	5	17724132	missense	possibly damaging	0.96
R6816:Sema3c	UTSW	5	17670465	missense	probably benign	0.36
R7146:Sema3c	UTSW	5	17694703	missense	probably benign	0.22
R7526:Sema3c	UTSW	5	17727596	missense	possibly damaging	0.46
R7832:Sema3c	UTSW	5	17694847	missense	probably damaging	0.99
R8034:Sema3c	UTSW	5	17727482	missense	probably damaging	1.00
R8053:Sema3c	UTSW	5	17655022	missense	probably benign	0.00
R8076:Sema3c	UTSW	5	17727364	missense	probably benign	0.00
R8264:Sema3c	UTSW	5	17676539	intron	probably benign
R8359:Sema3c	UTSW	5	17653728	missense	possibly damaging	0.56
R8437:Sema3c	UTSW	5	17662938	missense	probably damaging	0.99
R9174:Sema3c	UTSW	5	17663041	critical splice donor site	probably null
R9295:Sema3c	UTSW	5	17727497	missense	probably benign	0.09
R9477:Sema3c	UTSW	5	17716983	missense
R9599:Sema3c	UTSW	5	17714454	critical splice donor site	probably null
R9702:Sema3c	UTSW	5	17653830	missense	probably damaging	1.00
Z1176:Sema3c	UTSW	5	17727519	missense	probably benign	0.04
Z1177:Sema3c	UTSW	5	17717031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCAGTTGCAAAGACTTTCAGAC -3'
(R):5'- CAGTACGTTAAGCTTTCATCTGAG -3'

Sequencing Primer
(F):5'- AGACACAAATAAATCAAAAGGTTTCC -3'
(R):5'- AACTCTTGCTTGGGGCT -3'

Posted On

2015-07-21