Incidental Mutation 'R4449:Sema3c'
ID328875
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms1110036B02Rik, Semae
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location17574281-17730268 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 17576846 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568] [ENSMUST00000169603] [ENSMUST00000170181]
Predicted Effect probably benign
Transcript: ENSMUST00000030568
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169603
SMART Domains Protein: ENSMUSP00000132330
Gene: ENSMUSG00000028780

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Sema 54 226 9.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170348
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17694860 missense probably damaging 1.00
IGL01528:Sema3c APN 5 17714415 missense probably benign
IGL01618:Sema3c APN 5 17672506 missense probably damaging 1.00
IGL01730:Sema3c APN 5 17711436 missense probably benign 0.01
IGL01762:Sema3c APN 5 17694851 missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17721925 splice site probably benign
IGL02249:Sema3c APN 5 17662963 missense probably damaging 1.00
IGL02657:Sema3c APN 5 17576868 start codon destroyed possibly damaging 0.71
IGL02657:Sema3c APN 5 17662974 missense probably damaging 1.00
IGL03213:Sema3c APN 5 17694639 splice site probably benign
PIT4651001:Sema3c UTSW 5 17694733 missense probably benign 0.37
R0031:Sema3c UTSW 5 17694728 missense probably damaging 1.00
R0558:Sema3c UTSW 5 17714415 missense probably benign 0.00
R0964:Sema3c UTSW 5 17721909 missense probably damaging 1.00
R1164:Sema3c UTSW 5 17678314 missense probably benign 0.40
R1351:Sema3c UTSW 5 17678336 missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17678332 missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17682031 missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17727466 nonsense probably null
R1916:Sema3c UTSW 5 17727401 missense probably benign 0.06
R3934:Sema3c UTSW 5 17681940 missense probably damaging 0.97
R4284:Sema3c UTSW 5 17678347 missense probably benign 0.01
R4545:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4546:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4660:Sema3c UTSW 5 17672513 missense probably damaging 1.00
R4890:Sema3c UTSW 5 17675159 missense probably benign 0.00
R4937:Sema3c UTSW 5 17694686 missense probably benign 0.01
R5065:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17717070 critical splice donor site probably null
R5586:Sema3c UTSW 5 17711424 missense probably damaging 0.99
R5811:Sema3c UTSW 5 17675190 splice site probably null
R5886:Sema3c UTSW 5 17681986 missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17727632 missense probably benign 0.00
R6191:Sema3c UTSW 5 17653806 missense probably damaging 1.00
R6318:Sema3c UTSW 5 17672432 missense probably damaging 0.96
R6416:Sema3c UTSW 5 17576961 missense probably damaging 0.99
R6441:Sema3c UTSW 5 17724132 missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17670465 missense probably benign 0.36
R7146:Sema3c UTSW 5 17694703 missense probably benign 0.22
R7526:Sema3c UTSW 5 17727596 missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R7915:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R8034:Sema3c UTSW 5 17727482 missense probably damaging 1.00
R8053:Sema3c UTSW 5 17655022 missense probably benign 0.00
Z1176:Sema3c UTSW 5 17727519 missense probably benign 0.04
Z1177:Sema3c UTSW 5 17717031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTTGCAAAGACTTTCAGAC -3'
(R):5'- CAGTACGTTAAGCTTTCATCTGAG -3'

Sequencing Primer
(F):5'- AGACACAAATAAATCAAAAGGTTTCC -3'
(R):5'- AACTCTTGCTTGGGGCT -3'
Posted On2015-07-21