Incidental Mutation 'R4449:Slc15a4'
ID328877
Institutional Source Beutler Lab
Gene Symbol Slc15a4
Ensembl Gene ENSMUSG00000029416
Gene Namesolute carrier family 15, member 4
SynonymsPHT1, C130069N12Rik, PTR4
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location127595664-127632897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127604536 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]
Predicted Effect probably null
Transcript: ENSMUST00000031367
SMART Domains Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Pfam:MFS_1 33 505 7.8e-13 PFAM
Pfam:PTR2 96 519 3.6e-127 PFAM
transmembrane domain 533 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124569
SMART Domains Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTR2 49 242 8.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144603
SMART Domains Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 127 2.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153832
SMART Domains Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:PTR2 96 292 5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155321
SMART Domains Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 105 1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200212
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Slc15a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc15a4 APN 5 127601960 missense probably benign 0.13
IGL01543:Slc15a4 APN 5 127603766 missense probably benign 0.12
IGL01805:Slc15a4 APN 5 127608836 missense possibly damaging 0.91
IGL02958:Slc15a4 APN 5 127604665 missense possibly damaging 0.93
IGL03367:Slc15a4 APN 5 127601941 missense probably damaging 1.00
feeble UTSW 5 127608770 unclassified probably benign
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0838:Slc15a4 UTSW 5 127617003 missense possibly damaging 0.53
R1544:Slc15a4 UTSW 5 127603768 missense probably benign 0.01
R1662:Slc15a4 UTSW 5 127608979 missense probably damaging 1.00
R2504:Slc15a4 UTSW 5 127617239 missense possibly damaging 0.92
R2843:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2845:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2846:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2900:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2971:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3018:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3020:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3021:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3027:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3053:Slc15a4 UTSW 5 127596682 missense possibly damaging 0.83
R3155:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3432:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4356:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4357:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4359:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4448:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4450:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4514:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4544:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4546:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4952:Slc15a4 UTSW 5 127603837 missense probably damaging 1.00
R5278:Slc15a4 UTSW 5 127616969 missense probably damaging 0.99
R6393:Slc15a4 UTSW 5 127616886 missense probably benign 0.13
R6527:Slc15a4 UTSW 5 127596709 missense probably damaging 1.00
R7409:Slc15a4 UTSW 5 127604678 missense probably benign 0.04
Z1177:Slc15a4 UTSW 5 127600524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCAGGCACCCAAATG -3'
(R):5'- GAGCATTGTCACTAGGGGTG -3'

Sequencing Primer
(F):5'- TTCCAGGCACCCAAATGACAAAG -3'
(R):5'- TGTTTCCCAAAGTGAAGGCC -3'
Posted On2015-07-21