Incidental Mutation 'R4449:Igkv3-2'
ID328879
Institutional Source Beutler Lab
Gene Symbol Igkv3-2
Ensembl Gene ENSMUSG00000095351
Gene Nameimmunoglobulin kappa variable 3-2
SynonymsV(kappa)21A
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location70698468-70699067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70698841 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 45 (A45T)
Ref Sequence ENSEMBL: ENSMUSP00000100204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103403] [ENSMUST00000103404]
Predicted Effect probably benign
Transcript: ENSMUST00000103403
AA Change: A45T

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100204
Gene: ENSMUSG00000095351
AA Change: A45T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 114 5.39e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103404
SMART Domains Protein: ENSMUSP00000100205
Gene: ENSMUSG00000095682

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 114 3.96e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Igkv3-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Igkv3-2 APN 6 70698994 missense probably damaging 0.98
IGL02352:Igkv3-2 APN 6 70698490 missense probably damaging 0.96
IGL02359:Igkv3-2 APN 6 70698490 missense probably damaging 0.96
IGL02627:Igkv3-2 APN 6 70698826 missense probably damaging 1.00
R3714:Igkv3-2 UTSW 6 70698496 missense possibly damaging 0.66
R4255:Igkv3-2 UTSW 6 70699061 missense probably benign 0.00
R4663:Igkv3-2 UTSW 6 70698879 missense probably benign 0.02
R5361:Igkv3-2 UTSW 6 70699027 missense probably benign 0.01
R6347:Igkv3-2 UTSW 6 70699033 missense probably benign 0.01
R6466:Igkv3-2 UTSW 6 70699039 missense probably benign 0.15
R6761:Igkv3-2 UTSW 6 70698517 critical splice donor site probably benign
R6874:Igkv3-2 UTSW 6 70698838 nonsense probably null
R8050:Igkv3-2 UTSW 6 70699004 missense probably damaging 1.00
Z1177:Igkv3-2 UTSW 6 70699015 nonsense probably null
Z1177:Igkv3-2 UTSW 6 70699046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGATTCCTCAGTCCCCTGG -3'
(R):5'- GCAGTATCATCCTCCTCCATAG -3'

Sequencing Primer
(F):5'- TGGTTTCTCAGAGTGATATCCAC -3'
(R):5'- ATAGGATGGATGTTGAGGCTGAAGTC -3'
Posted On2015-07-21