Incidental Mutation 'R4449:Olfr593'
ID328881
Institutional Source Beutler Lab
Gene Symbol Olfr593
Ensembl Gene ENSMUSG00000073955
Gene Nameolfactory receptor 593
SynonymsGA_x6K02T2PBJ9-5927412-5928362, MOR24-2
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103211862-103212845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103212480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 196 (I196F)
Ref Sequence ENSEMBL: ENSMUSP00000147588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098206] [ENSMUST00000210686] [ENSMUST00000214051]
Predicted Effect probably benign
Transcript: ENSMUST00000098206
AA Change: I207F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095807
Gene: ENSMUSG00000073955
AA Change: I207F

DomainStartEndE-ValueType
Pfam:7tm_4 44 323 4.9e-106 PFAM
Pfam:7TM_GPCR_Srsx 48 320 2.6e-8 PFAM
Pfam:7tm_1 54 305 6.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210686
AA Change: I196F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214051
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Olfr593
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Olfr593 APN 7 103212685 missense probably damaging 1.00
IGL01636:Olfr593 APN 7 103212177 missense probably benign
IGL01637:Olfr593 APN 7 103212177 missense probably benign
IGL02115:Olfr593 APN 7 103212474 missense probably damaging 1.00
IGL02668:Olfr593 APN 7 103212735 missense possibly damaging 0.88
IGL03063:Olfr593 APN 7 103212634 missense probably damaging 0.96
IGL03070:Olfr593 APN 7 103212697 missense probably benign 0.02
IGL03114:Olfr593 APN 7 103212721 missense probably damaging 1.00
R0144:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0238:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0239:Olfr593 UTSW 7 103212726 missense possibly damaging 0.93
R0309:Olfr593 UTSW 7 103212721 missense probably damaging 1.00
R0602:Olfr593 UTSW 7 103212580 missense possibly damaging 0.76
R0677:Olfr593 UTSW 7 103212798 nonsense probably null
R0783:Olfr593 UTSW 7 103212670 missense probably damaging 1.00
R1829:Olfr593 UTSW 7 103211886 missense probably benign 0.01
R3840:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R3841:Olfr593 UTSW 7 103212693 missense probably damaging 1.00
R4898:Olfr593 UTSW 7 103212540 missense probably damaging 1.00
R5197:Olfr593 UTSW 7 103212000 missense probably benign 0.02
R5285:Olfr593 UTSW 7 103212798 nonsense probably null
R6548:Olfr593 UTSW 7 103211904 missense probably benign 0.08
R7353:Olfr593 UTSW 7 103212309 missense probably damaging 1.00
R7362:Olfr593 UTSW 7 103212654 missense probably damaging 1.00
R7663:Olfr593 UTSW 7 103212445 missense possibly damaging 0.74
R7799:Olfr593 UTSW 7 103211979 missense probably benign 0.33
X0067:Olfr593 UTSW 7 103212048 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGACACTCAGCTATTTTGACACAC -3'
(R):5'- ATATGCACTTGGGGAGCCAC -3'

Sequencing Primer
(F):5'- TTTGACACACACTGTAACTGGAGG -3'
(R):5'- ACCTTGTGCCCAAATCTATGG -3'
Posted On2015-07-21