Incidental Mutation 'R4449:Cadm1'
ID328888
Institutional Source Beutler Lab
Gene Symbol Cadm1
Ensembl Gene ENSMUSG00000032076
Gene Namecell adhesion molecule 1
SynonymsSynCam, RA175A, Igsf4a, RA175B, RA175C, RA175N, Igsf4, 2900073G06Rik, 3100001I08Rik, SgIGSF, Tslc1, Necl2
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location47530173-47857637 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 47813988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034581] [ENSMUST00000085909] [ENSMUST00000114547] [ENSMUST00000114548] [ENSMUST00000143026] [ENSMUST00000152459]
Predicted Effect probably benign
Transcript: ENSMUST00000034581
SMART Domains Protein: ENSMUSP00000034581
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 345 360 N/A INTRINSIC
4.1m 370 388 1.5e-3 SMART
low complexity region 389 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085909
SMART Domains Protein: ENSMUSP00000083073
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 368 N/A INTRINSIC
low complexity region 384 399 N/A INTRINSIC
4.1m 409 427 1.5e-3 SMART
low complexity region 428 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114547
SMART Domains Protein: ENSMUSP00000110194
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 362 N/A INTRINSIC
low complexity region 373 388 N/A INTRINSIC
4.1m 398 416 1.5e-3 SMART
low complexity region 417 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114548
SMART Domains Protein: ENSMUSP00000110195
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 356 371 N/A INTRINSIC
4.1m 381 399 1.5e-3 SMART
low complexity region 400 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124073
Predicted Effect probably benign
Transcript: ENSMUST00000143026
SMART Domains Protein: ENSMUSP00000124555
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
low complexity region 13 41 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151624
Predicted Effect probably benign
Transcript: ENSMUST00000152459
SMART Domains Protein: ENSMUSP00000124119
Gene: ENSMUSG00000032076

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
IG 52 144 3.33e-9 SMART
IG_like 160 230 8.08e-1 SMART
IGc2 261 323 2.08e-10 SMART
low complexity region 336 368 N/A INTRINSIC
low complexity region 402 417 N/A INTRINSIC
4.1m 427 445 1.5e-3 SMART
low complexity region 446 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygous mutant male show infertility due to block in maturation of spermatogenesis. Mice homozygous for a gene trap allele exhibit decreased body size, impaired T cell development, and impaired T cell response to anti-CD3/CD28 antibody stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Cadm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Cadm1 APN 9 47850324 missense probably damaging 1.00
IGL01899:Cadm1 APN 9 47810091 missense probably damaging 0.97
IGL02154:Cadm1 APN 9 47813903 missense probably benign 0.00
IGL03196:Cadm1 APN 9 47799377 missense possibly damaging 0.81
R0053:Cadm1 UTSW 9 47799414 missense probably damaging 1.00
R0053:Cadm1 UTSW 9 47799414 missense probably damaging 1.00
R0058:Cadm1 UTSW 9 47850331 missense probably damaging 1.00
R0058:Cadm1 UTSW 9 47850331 missense probably damaging 1.00
R0671:Cadm1 UTSW 9 47813806 missense probably benign 0.30
R0717:Cadm1 UTSW 9 47810068 missense probably benign 0.14
R1622:Cadm1 UTSW 9 47813841 missense probably benign 0.35
R1817:Cadm1 UTSW 9 47829370 splice site probably benign
R1958:Cadm1 UTSW 9 47850335 missense probably damaging 1.00
R3124:Cadm1 UTSW 9 47799477 missense possibly damaging 0.94
R4214:Cadm1 UTSW 9 47797443 missense probably damaging 0.99
R4449:Cadm1 UTSW 9 47530437 missense possibly damaging 0.85
R4701:Cadm1 UTSW 9 47818822 splice site probably benign
R5932:Cadm1 UTSW 9 47799451 missense probably damaging 1.00
R6013:Cadm1 UTSW 9 47857274 unclassified probably benign
R6315:Cadm1 UTSW 9 47810119 missense probably damaging 0.98
R6481:Cadm1 UTSW 9 47788109 missense probably damaging 1.00
R7121:Cadm1 UTSW 9 47799410 missense probably damaging 1.00
R7582:Cadm1 UTSW 9 47797442 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACATGCCGTACTGTCTGG -3'
(R):5'- AGGACAGCCTTCCTTCTCAG -3'

Sequencing Primer
(F):5'- TACTGTCTGGGCCAAACCTG -3'
(R):5'- CATGACCAGAGACTATGATCTTGTGG -3'
Posted On2015-07-21