Incidental Mutation 'R4449:Myl7'
ID328892
Institutional Source Beutler Lab
Gene Symbol Myl7
Ensembl Gene ENSMUSG00000020469
Gene Namemyosin, light polypeptide 7, regulatory
SynonymsRLC-A, MLC-2alpha, MLC2a, Mylc2a
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4449 (G1)
Quality Score176
Status Validated
Chromosome11
Chromosomal Location5896637-5898782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5897354 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 115 (D115N)
Ref Sequence ENSEMBL: ENSMUSP00000099985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102920] [ENSMUST00000102921] [ENSMUST00000109822] [ENSMUST00000109823]
Predicted Effect probably benign
Transcript: ENSMUST00000102920
SMART Domains Protein: ENSMUSP00000099984
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 4.3e-80 PFAM
Pfam:Hexokinase_2 219 458 1.3e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102921
AA Change: D115N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099985
Gene: ENSMUSG00000020469
AA Change: D115N

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
EFh 36 64 1.02e-2 SMART
EFh 106 134 8.25e-3 SMART
Blast:EFh 142 170 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109822
SMART Domains Protein: ENSMUSP00000105447
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 1e-79 PFAM
Pfam:Hexokinase_2 219 458 7.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109823
SMART Domains Protein: ENSMUSP00000105448
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 15 216 1.9e-74 PFAM
Pfam:Hexokinase_2 221 455 2.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125434
SMART Domains Protein: ENSMUSP00000123016
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
Pfam:Hexokinase_2 45 87 1.1e-8 PFAM
Meta Mutation Damage Score 0.6857 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-in allele show lack of atrial myofibrillar organization, atrial malfunction, aberrant cardiac chamber and looping morphogenesis, defects in yolk sac and intraembryonic vasculature, growth arrest, pericardial edema, and death at E10.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Myl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Myl7 APN 11 5897137 missense possibly damaging 0.84
IGL03199:Myl7 APN 11 5898205 missense probably damaging 1.00
R2370:Myl7 UTSW 11 5896684 missense probably damaging 0.96
R3902:Myl7 UTSW 11 5898430 missense probably damaging 1.00
R3902:Myl7 UTSW 11 5898431 missense probably damaging 0.99
R4766:Myl7 UTSW 11 5898171 missense probably benign 0.00
R5293:Myl7 UTSW 11 5898521 unclassified probably benign
R7666:Myl7 UTSW 11 5897140 missense possibly damaging 0.76
R7862:Myl7 UTSW 11 5897157 missense probably benign 0.01
R7945:Myl7 UTSW 11 5897157 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGCTTGAACCTGAGGAG -3'
(R):5'- CAACCCCTTTGATGCCCAAG -3'

Sequencing Primer
(F):5'- CTTGAACCTGAGGAGAGAGAATGCC -3'
(R):5'- TTTGATGCCCAAGAAACACTCTG -3'
Posted On2015-07-21