Incidental Mutation 'R4449:Cntrob'
ID328895
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Namecentrobin, centrosomal BRCA2 interacting protein
SynonymsLip8, 9830165K03Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4449 (G1)
Quality Score212
Status Validated
Chromosome11
Chromosomal Location69299487-69323775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69305549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 687 (D687Y)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
Predicted Effect probably benign
Transcript: ENSMUST00000092973
AA Change: D687Y

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: D687Y

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156175
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.1403 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69319373 missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69310027 missense possibly damaging 0.90
groats UTSW 11 69309491 nonsense probably null
R0270:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69322868 missense probably damaging 1.00
R1749:Cntrob UTSW 11 69322874 missense probably damaging 0.99
R1775:Cntrob UTSW 11 69320867 missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69308054 missense probably benign 0.27
R1967:Cntrob UTSW 11 69320963 missense probably damaging 0.97
R2495:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R3121:Cntrob UTSW 11 69322700 nonsense probably null
R3780:Cntrob UTSW 11 69302882 missense probably damaging 0.97
R4696:Cntrob UTSW 11 69320888 missense probably damaging 1.00
R4841:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69320906 missense probably damaging 0.97
R4982:Cntrob UTSW 11 69311362 unclassified probably null
R5168:Cntrob UTSW 11 69299990 missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69321891 missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69314750 missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69322753 missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69309375 missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69311422 missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R6964:Cntrob UTSW 11 69309491 nonsense probably null
R7020:Cntrob UTSW 11 69303092 critical splice donor site probably null
R7425:Cntrob UTSW 11 69314734 nonsense probably null
Z1177:Cntrob UTSW 11 69311449 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCACACAATTCATGAGCACTTGC -3'
(R):5'- GACCATCTTTCCTGGGTGTG -3'

Sequencing Primer
(F):5'- TGAGCACTTGCGCAGGC -3'
(R):5'- GACCAAATGTATGCCTGTGC -3'
Posted On2015-07-21