Incidental Mutation 'R4449:Unk'
ID328899
Institutional Source Beutler Lab
Gene Symbol Unk
Ensembl Gene ENSMUSG00000020770
Gene Nameunkempt family zinc finger
SynonymsZc3h5, B230379M23Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R4449 (G1)
Quality Score166
Status Validated
Chromosome11
Chromosomal Location116030322-116061214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116053634 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 404 (G404S)
Ref Sequence ENSEMBL: ENSMUSP00000102060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000106452]
Predicted Effect probably damaging
Transcript: ENSMUST00000021116
AA Change: G417S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770
AA Change: G417S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106452
AA Change: G404S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770
AA Change: G404S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176212
Meta Mutation Damage Score 0.2708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Unk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Unk APN 11 116058379 missense probably benign 0.44
IGL01956:Unk APN 11 116056334 missense probably damaging 1.00
IGL02044:Unk APN 11 116049328 missense probably damaging 0.99
IGL02738:Unk APN 11 116056191 missense probably damaging 1.00
IGL02861:Unk APN 11 116056299 missense possibly damaging 0.58
legal_midget UTSW 11 116050724 missense probably damaging 1.00
produce UTSW 11 116051459 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0827:Unk UTSW 11 116053109 missense possibly damaging 0.59
R1471:Unk UTSW 11 116049409 missense probably benign 0.45
R1824:Unk UTSW 11 116030442 unclassified probably benign
R1900:Unk UTSW 11 116059081 missense probably benign 0.01
R3052:Unk UTSW 11 116050123 missense probably benign 0.01
R4033:Unk UTSW 11 116053527 missense probably benign 0.00
R4593:Unk UTSW 11 116049056 missense probably benign 0.02
R4847:Unk UTSW 11 116054406 missense probably damaging 1.00
R4921:Unk UTSW 11 116054945 missense probably benign
R4940:Unk UTSW 11 116053665 missense possibly damaging 0.63
R5099:Unk UTSW 11 116059110 missense probably benign 0.00
R5838:Unk UTSW 11 116049331 missense probably damaging 1.00
R6351:Unk UTSW 11 116054946 missense probably benign
R6387:Unk UTSW 11 116054940 missense possibly damaging 0.88
R6551:Unk UTSW 11 116050724 missense probably damaging 1.00
R6554:Unk UTSW 11 116051459 missense probably damaging 1.00
R6599:Unk UTSW 11 116047802 missense probably damaging 1.00
R6733:Unk UTSW 11 116050755 missense probably damaging 1.00
R7743:Unk UTSW 11 116049436 missense possibly damaging 0.74
R7765:Unk UTSW 11 116053082 missense probably benign 0.25
Z1176:Unk UTSW 11 116047764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCCATCAACAACCTGTC -3'
(R):5'- AGTGAGAACAAACCCCTGAG -3'

Sequencing Primer
(F):5'- AACAACCTGTCCTCTTCTGCAG -3'
(R):5'- GCCTCAGCTGAGAAGCAG -3'
Posted On2015-07-21