Incidental Mutation 'R4449:Trappc12'
ID328900
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Nametrafficking protein particle complex 12
SynonymsTtc15, D930014A20Rik, CGI-87
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28690628-28750472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28747235 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 99 (D99E)
Ref Sequence ENSEMBL: ENSMUSP00000132009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000035657] [ENSMUST00000168129] [ENSMUST00000170994] [ENSMUST00000221555] [ENSMUST00000221877] [ENSMUST00000222407]
Predicted Effect probably benign
Transcript: ENSMUST00000020954
AA Change: D99E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: D99E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035657
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168129
AA Change: D99E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: D99E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170994
AA Change: D99E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132009
Gene: ENSMUSG00000020628
AA Change: D99E

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221335
Predicted Effect probably benign
Transcript: ENSMUST00000221555
Predicted Effect probably benign
Transcript: ENSMUST00000221877
Predicted Effect probably benign
Transcript: ENSMUST00000222407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223552
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28737836 missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28691854 splice site probably benign
IGL01295:Trappc12 APN 12 28746762 missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28747402 missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28746915 missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28692492 critical splice donor site probably null
IGL02851:Trappc12 APN 12 28691406 missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28747014 missense probably benign
IGL03163:Trappc12 APN 12 28746654 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28747260 missense probably benign 0.00
R0517:Trappc12 UTSW 12 28697134 splice site probably benign
R0837:Trappc12 UTSW 12 28703597 missense possibly damaging 0.92
R1439:Trappc12 UTSW 12 28747161 missense possibly damaging 0.96
R1477:Trappc12 UTSW 12 28737752 missense probably benign 0.25
R1651:Trappc12 UTSW 12 28691777 missense probably benign 0.32
R1899:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R1900:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28746598 missense probably benign 0.00
R2174:Trappc12 UTSW 12 28747381 missense possibly damaging 0.94
R5031:Trappc12 UTSW 12 28692513 missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28737794 missense probably benign 0.03
R5220:Trappc12 UTSW 12 28746697 missense probably damaging 0.97
R5458:Trappc12 UTSW 12 28746390 missense probably damaging 0.98
R5471:Trappc12 UTSW 12 28691500 missense probably damaging 1.00
R5482:Trappc12 UTSW 12 28691325 missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28746864 missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28691514 missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28747114 missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28747083 missense probably damaging 0.97
R7669:Trappc12 UTSW 12 28711958 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTTGAGTCTTCCTTCAGAGAG -3'
(R):5'- AGGTCCTGAAAACATCCCGG -3'

Sequencing Primer
(F):5'- AGAGGCTCTGCTATCAGGTGTC -3'
(R):5'- GCCATTGTACCATGAAGAGACCATTG -3'
Posted On2015-07-21