Incidental Mutation 'R4449:Arfgap3'
ID328904
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene NameADP-ribosylation factor GTPase activating protein 3
Synonyms1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83299739-83350247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83334558 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 105 (Y105N)
Ref Sequence ENSEMBL: ENSMUSP00000154712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]
Predicted Effect probably damaging
Transcript: ENSMUST00000067215
AA Change: Y105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: Y105N

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226124
AA Change: Y105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227511
Meta Mutation Damage Score 0.9641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83322589 missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83313509 missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83313557 missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83322650 missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83306926 missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83343081 missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83313509 missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0125:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83330513 splice site probably benign
R0551:Arfgap3 UTSW 15 83343137 missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83303185 missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83308188 splice site probably null
R1115:Arfgap3 UTSW 15 83330540 missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83306937 missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83313563 missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83303102 critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83310300 missense probably benign
R2084:Arfgap3 UTSW 15 83334566 missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83322607 missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4206:Arfgap3 UTSW 15 83322668 missense probably benign
R5004:Arfgap3 UTSW 15 83310296 missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83332697 missense probably benign 0.01
R5364:Arfgap3 UTSW 15 83314361 missense probably damaging 1.00
R6142:Arfgap3 UTSW 15 83350127 missense probably damaging 1.00
R6813:Arfgap3 UTSW 15 83330593 missense probably benign 0.00
R7154:Arfgap3 UTSW 15 83336704 missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83306949 missense probably damaging 0.97
R7582:Arfgap3 UTSW 15 83303101 missense possibly damaging 0.77
R7714:Arfgap3 UTSW 15 83308151 missense probably benign 0.34
Z1177:Arfgap3 UTSW 15 83332688 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAATTGACAAAGCAGAGCCC -3'
(R):5'- CTCGAAAGGGAAGTTTACTTTAGACC -3'

Sequencing Primer
(F):5'- AGAGCCCTTCTCATCACGAGG -3'
(R):5'- AGACCTTCTATGCTGTCTAGTTAG -3'
Posted On2015-07-21