Incidental Mutation 'R4449:Prpf40b'
ID328905
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Namepre-mRNA processing factor 40B
Synonyms2610317D23Rik
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99295087-99317018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99314663 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 596 (D596G)
Ref Sequence ENSEMBL: ENSMUSP00000115869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
Predicted Effect probably damaging
Transcript: ENSMUST00000023745
AA Change: D596G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007
AA Change: D596G

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118287
AA Change: D596G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007
AA Change: D596G

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124275
Predicted Effect probably benign
Transcript: ENSMUST00000126955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130575
Predicted Effect probably benign
Transcript: ENSMUST00000134034
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136980
AA Change: D583G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007
AA Change: D583G

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139330
Predicted Effect probably damaging
Transcript: ENSMUST00000145482
AA Change: D596G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007
AA Change: D596G

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153692
Meta Mutation Damage Score 0.6249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Twsg1 A C 17: 65,926,310 V215G possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0284:Prpf40b UTSW 15 99316393 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1220:Prpf40b UTSW 15 99316348 missense probably benign 0.10
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6734:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6776:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTGAACACCTTGCAG -3'
(R):5'- CTTCGAAAGGCAGCTTCTCTG -3'

Sequencing Primer
(F):5'- TGAACACCTTGCAGCCTGATC -3'
(R):5'- TTTTCCAGCAGCTGAAGGC -3'
Posted On2015-07-21