Incidental Mutation 'R4450:Slc11a1'
ID328909
Institutional Source Beutler Lab
Gene Symbol Slc11a1
Ensembl Gene ENSMUSG00000026177
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonymshost resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74375195-74386062 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to A at 74385535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]
Predicted Effect probably benign
Transcript: ENSMUST00000027368
SMART Domains Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177

DomainStartEndE-ValueType
Pfam:Nramp 75 460 1.5e-119 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149166
Predicted Effect probably benign
Transcript: ENSMUST00000187516
SMART Domains Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177

DomainStartEndE-ValueType
Pfam:Nramp 46 419 1.4e-109 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Slc11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Slc11a1 APN 1 74381898 splice site probably null
IGL00813:Slc11a1 APN 1 74383480 missense probably benign 0.03
IGL00970:Slc11a1 APN 1 74380662 missense probably damaging 1.00
IGL01017:Slc11a1 APN 1 74379796 missense probably damaging 1.00
IGL01646:Slc11a1 APN 1 74384740 missense probably damaging 0.99
IGL01941:Slc11a1 APN 1 74377179 missense probably damaging 1.00
IGL01996:Slc11a1 APN 1 74376806 missense possibly damaging 0.93
IGL02580:Slc11a1 APN 1 74380259 missense probably damaging 0.99
IGL02586:Slc11a1 APN 1 74385132 splice site probably benign
IGL02961:Slc11a1 APN 1 74377173 missense probably damaging 1.00
R1813:Slc11a1 UTSW 1 74375772 missense probably benign
R1896:Slc11a1 UTSW 1 74375772 missense probably benign
R2219:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2220:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2416:Slc11a1 UTSW 1 74383644 missense probably damaging 0.96
R2432:Slc11a1 UTSW 1 74383751 splice site probably benign
R3893:Slc11a1 UTSW 1 74384706 missense probably damaging 1.00
R4638:Slc11a1 UTSW 1 74375278 start gained probably benign
R4782:Slc11a1 UTSW 1 74384088 missense probably damaging 0.98
R5068:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5069:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5070:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5215:Slc11a1 UTSW 1 74383777 intron probably benign
R5333:Slc11a1 UTSW 1 74384145 missense probably damaging 1.00
R5613:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5621:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5622:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5950:Slc11a1 UTSW 1 74377176 missense probably benign 0.40
R6239:Slc11a1 UTSW 1 74384115 missense possibly damaging 0.82
R6776:Slc11a1 UTSW 1 74384085 missense probably damaging 1.00
R7199:Slc11a1 UTSW 1 74383671 missense possibly damaging 0.83
R7356:Slc11a1 UTSW 1 74385489 missense probably benign
R8142:Slc11a1 UTSW 1 74385259 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCTGGTACTGGGGTCAGC -3'
(R):5'- CAATGGAGTTGTGGCAGTTC -3'

Sequencing Primer
(F):5'- ACACAGGGGGCTTCTGAG -3'
(R):5'- GAATCCCCATCTTCTGAAAGGGTG -3'
Posted On2015-07-21