Incidental Mutation 'R4450:Lmo2'
ID328910
Institutional Source Beutler Lab
Gene Symbol Lmo2
Ensembl Gene ENSMUSG00000032698
Gene NameLIM domain only 2
SynonymsRbtn2, Rhom-2, Rbtn-2
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103957986-103981878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103981062 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 147 (Y147H)
Ref Sequence ENSEMBL: ENSMUSP00000106769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111139] [ENSMUST00000111140] [ENSMUST00000111143] [ENSMUST00000123437] [ENSMUST00000138815] [ENSMUST00000156813] [ENSMUST00000170926]
Predicted Effect probably damaging
Transcript: ENSMUST00000111139
AA Change: Y147H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106769
Gene: ENSMUSG00000032698
AA Change: Y147H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 91 145 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111140
AA Change: Y219H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106770
Gene: ENSMUSG00000032698
AA Change: Y219H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 99 153 4.03e-10 SMART
LIM 163 217 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111143
AA Change: Y211H

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106773
Gene: ENSMUSG00000032698
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
LIM 91 145 4.03e-10 SMART
LIM 155 209 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123437
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117703
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133210
Predicted Effect probably benign
Transcript: ENSMUST00000138815
SMART Domains Protein: ENSMUSP00000121927
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
Pfam:LIM 30 59 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156813
SMART Domains Protein: ENSMUSP00000122369
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 144 1.36e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170926
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128317
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lack of yolk sac erythropoiesis and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Lmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Lmo2 APN 2 103981087 missense probably benign 0.21
R1983:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2013:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2014:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2131:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2132:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2133:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2233:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2235:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2510:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3038:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3813:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4058:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4059:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4448:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4544:Lmo2 UTSW 2 103976037 missense probably damaging 1.00
R4805:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4808:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4975:Lmo2 UTSW 2 103976143 nonsense probably null
R5310:Lmo2 UTSW 2 103976100 missense probably damaging 0.98
R5823:Lmo2 UTSW 2 103981072 missense probably damaging 1.00
R6267:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6296:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6949:Lmo2 UTSW 2 103970673 start codon destroyed probably null 0.53
R8051:Lmo2 UTSW 2 103970700 missense possibly damaging 0.95
R8719:Lmo2 UTSW 2 103980919 missense probably damaging 0.98
R8746:Lmo2 UTSW 2 103976039 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCTGTGCATCCTGTGACAAGC -3'
(R):5'- TTCTCTCTAAGGGCTGGTCC -3'

Sequencing Primer
(F):5'- ATCCTGTGACAAGCGGATC -3'
(R):5'- GAAGTCTCAGCCTTTGCATTATG -3'
Posted On2015-07-21