Incidental Mutation 'R4450:Bpifb6'
ID328911
Institutional Source Beutler Lab
Gene Symbol Bpifb6
Ensembl Gene ENSMUSG00000068009
Gene NameBPI fold containing family B, member 6
SynonymsLOC228796, Bpil3
MMRRC Submission 041711-MU
Accession Numbers

Genbank: NM_199303; MGI: 2684965

Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153900388-153912795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153906768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 228 (E228G)
Ref Sequence ENSEMBL: ENSMUSP00000119046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088955] [ENSMUST00000135501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088955
AA Change: E228G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086347
Gene: ENSMUSG00000068009
AA Change: E228G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
BPI1 22 228 7.83e-3 SMART
BPI2 245 446 2.5e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135501
AA Change: E228G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119046
Gene: ENSMUSG00000068009
AA Change: E228G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
BPI1 22 228 7.83e-3 SMART
Blast:BPI2 245 279 1e-11 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Bpifb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Bpifb6 APN 2 153902645 missense unknown
IGL03143:Bpifb6 APN 2 153902735 missense probably damaging 1.00
R0157:Bpifb6 UTSW 2 153903966 missense probably benign 0.04
R1607:Bpifb6 UTSW 2 153906861 missense probably damaging 1.00
R1678:Bpifb6 UTSW 2 153908642 missense probably damaging 0.96
R1745:Bpifb6 UTSW 2 153911483 missense possibly damaging 0.85
R1786:Bpifb6 UTSW 2 153906861 missense probably damaging 1.00
R1990:Bpifb6 UTSW 2 153905350 critical splice donor site probably null
R2087:Bpifb6 UTSW 2 153906078 missense possibly damaging 0.88
R3717:Bpifb6 UTSW 2 153908141 unclassified probably benign
R4449:Bpifb6 UTSW 2 153906768 missense possibly damaging 0.56
R4709:Bpifb6 UTSW 2 153908516 missense possibly damaging 0.87
R4710:Bpifb6 UTSW 2 153908516 missense possibly damaging 0.87
R6113:Bpifb6 UTSW 2 153910731 missense probably benign
R6267:Bpifb6 UTSW 2 153906892 missense possibly damaging 0.50
R6296:Bpifb6 UTSW 2 153906892 missense possibly damaging 0.50
R6406:Bpifb6 UTSW 2 153904537 missense possibly damaging 0.88
R7049:Bpifb6 UTSW 2 153908813 splice site probably null
R7098:Bpifb6 UTSW 2 153906890 nonsense probably null
R7740:Bpifb6 UTSW 2 153903009 missense probably damaging 1.00
R8673:Bpifb6 UTSW 2 153905292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCTCTCAAGTCACACC -3'
(R):5'- CCATCAGCAGTTCTGCATCC -3'

Sequencing Primer
(F):5'- GTCACACCCGCCCACTTC -3'
(R):5'- AGCAGTTCTGCATCCGACTC -3'
Posted On2015-07-21