Incidental Mutation 'R4450:Syt6'
ID328912
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Namesynaptotagmin VI
Synonyms3110037A08Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103575231-103645569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103585645 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 156 (H156R)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
Predicted Effect probably benign
Transcript: ENSMUST00000090697
AA Change: H156R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: H156R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117221
AA Change: H71R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: H71R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118117
AA Change: H71R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: H71R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118563
AA Change: H71R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: H71R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121834
AA Change: H156R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: H156R

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000183637
AA Change: H71R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849
AA Change: H71R

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCTGCTTCAGAGACTCTC -3'
(R):5'- AGGTTCCTGGTTCATCACACC -3'

Sequencing Primer
(F):5'- CTGCTTCAGAGACTCTCCAGAG -3'
(R):5'- CTGCTCTGGTCCTCAAAGAACATATG -3'
Posted On2015-07-21