Incidental Mutation 'R4450:Rnpc3'
ID328913
Institutional Source Beutler Lab
Gene Symbol Rnpc3
Ensembl Gene ENSMUSG00000027981
Gene NameRNA-binding region (RNP1, RRM) containing 3
Synonyms
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location113605067-113630149 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 113611137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092154] [ENSMUST00000106535] [ENSMUST00000106536] [ENSMUST00000174147]
Predicted Effect probably benign
Transcript: ENSMUST00000092154
SMART Domains Protein: ENSMUSP00000089792
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106535
SMART Domains Protein: ENSMUSP00000102145
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 4.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106536
SMART Domains Protein: ENSMUSP00000102146
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132220
Predicted Effect probably benign
Transcript: ENSMUST00000153853
SMART Domains Protein: ENSMUSP00000115492
Gene: ENSMUSG00000027981

DomainStartEndE-ValueType
Blast:RRM 2 47 8e-22 BLAST
SCOP:d1urna_ 3 53 4e-4 SMART
low complexity region 167 202 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
RRM 368 446 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174147
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Rnpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Rnpc3 APN 3 113608399 missense probably damaging 1.00
IGL02750:Rnpc3 APN 3 113621939 missense possibly damaging 0.81
R0316:Rnpc3 UTSW 3 113629973 missense probably damaging 1.00
R0420:Rnpc3 UTSW 3 113621869 missense probably benign 0.00
R0601:Rnpc3 UTSW 3 113620106 missense probably benign 0.18
R1051:Rnpc3 UTSW 3 113629946 missense possibly damaging 0.94
R1386:Rnpc3 UTSW 3 113613784 nonsense probably null
R1865:Rnpc3 UTSW 3 113621910 nonsense probably null
R1870:Rnpc3 UTSW 3 113611055 unclassified probably benign
R2045:Rnpc3 UTSW 3 113608360 missense possibly damaging 0.90
R4447:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4934:Rnpc3 UTSW 3 113624979 missense possibly damaging 0.86
R5436:Rnpc3 UTSW 3 113624999 missense probably damaging 1.00
R5474:Rnpc3 UTSW 3 113615509 nonsense probably null
R5498:Rnpc3 UTSW 3 113611207 critical splice donor site probably null
R5505:Rnpc3 UTSW 3 113615453 missense probably damaging 0.98
R5868:Rnpc3 UTSW 3 113616711 splice site probably null
R6123:Rnpc3 UTSW 3 113609056 splice site probably null
R7220:Rnpc3 UTSW 3 113628355 missense probably benign 0.01
R7240:Rnpc3 UTSW 3 113616831 missense probably damaging 1.00
R7507:Rnpc3 UTSW 3 113616761 missense probably benign
R7537:Rnpc3 UTSW 3 113613832 missense probably benign
R7818:Rnpc3 UTSW 3 113629951 missense probably damaging 1.00
R7872:Rnpc3 UTSW 3 113622447 nonsense probably null
R8738:Rnpc3 UTSW 3 113621156 missense probably benign 0.13
RF023:Rnpc3 UTSW 3 113620074 missense probably damaging 0.98
X0012:Rnpc3 UTSW 3 113629909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAAAAGCTTAGGCACAAAAC -3'
(R):5'- GCTACTGTTGTCTGCTGTAAAC -3'

Sequencing Primer
(F):5'- GCAGCTTTCATAGTAGGAAAAACAC -3'
(R):5'- GCCTTTTTAGCATTTACAATGGAGTG -3'
Posted On2015-07-21