Incidental Mutation 'R4450:Nsun4'
ID328914
Institutional Source Beutler Lab
Gene Symbol Nsun4
Ensembl Gene ENSMUSG00000028706
Gene NameNOL1/NOP2/Sun domain family, member 4
Synonyms
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116032842-116053876 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 116051256 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 702 (Y702*)
Ref Sequence ENSEMBL: ENSMUSP00000130430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030474] [ENSMUST00000030475] [ENSMUST00000165493]
Predicted Effect probably benign
Transcript: ENSMUST00000030474
SMART Domains Protein: ENSMUSP00000030474
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 28 199 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030475
SMART Domains Protein: ENSMUSP00000030475
Gene: ENSMUSG00000028706

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 163 356 9.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152712
Predicted Effect probably null
Transcript: ENSMUST00000165493
AA Change: Y702*
SMART Domains Protein: ENSMUSP00000130430
Gene: ENSMUSG00000028706
AA Change: Y702*

DomainStartEndE-ValueType
low complexity region 91 124 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 553 565 N/A INTRINSIC
low complexity region 572 596 N/A INTRINSIC
low complexity region 677 700 N/A INTRINSIC
low complexity region 710 723 N/A INTRINSIC
low complexity region 733 756 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Nsun4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Nsun4 UTSW 4 116035773 missense probably benign 0.01
R0306:Nsun4 UTSW 4 116052822 nonsense probably null
R0365:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R1440:Nsun4 UTSW 4 116052950 missense possibly damaging 0.83
R1624:Nsun4 UTSW 4 116034200 missense probably benign 0.05
R2058:Nsun4 UTSW 4 116053680 splice site probably null
R2262:Nsun4 UTSW 4 116052950 missense probably benign 0.27
R2438:Nsun4 UTSW 4 116048597 missense probably benign 0.01
R3029:Nsun4 UTSW 4 116052725 missense possibly damaging 0.83
R4012:Nsun4 UTSW 4 116051062 missense possibly damaging 0.66
R4162:Nsun4 UTSW 4 116034194 nonsense probably null
R4166:Nsun4 UTSW 4 116034051 missense probably damaging 0.98
R4277:Nsun4 UTSW 4 116034282 missense probably damaging 1.00
R4433:Nsun4 UTSW 4 116040130 missense possibly damaging 0.75
R5077:Nsun4 UTSW 4 116048584 missense probably benign 0.00
R5307:Nsun4 UTSW 4 116034138 missense probably damaging 0.98
R5509:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R5510:Nsun4 UTSW 4 116051777 missense possibly damaging 0.46
R6145:Nsun4 UTSW 4 116040206 missense probably damaging 1.00
R6520:Nsun4 UTSW 4 116044738 missense probably damaging 1.00
R6848:Nsun4 UTSW 4 116052934 missense possibly damaging 0.90
R7346:Nsun4 UTSW 4 116051838 missense probably benign 0.01
R7528:Nsun4 UTSW 4 116034194 nonsense probably null
R7560:Nsun4 UTSW 4 116051494 missense possibly damaging 0.92
R7719:Nsun4 UTSW 4 116052420 missense possibly damaging 0.82
R7798:Nsun4 UTSW 4 116051174 missense possibly damaging 0.83
R7868:Nsun4 UTSW 4 116034132 missense probably benign
R7951:Nsun4 UTSW 4 116034132 missense probably benign
R8074:Nsun4 UTSW 4 116051434 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGACACCCATGTTGGTACTCTC -3'
(R):5'- TTGAGAACACCCTTTGACCCC -3'

Sequencing Primer
(F):5'- GGTACTCTCATTACGGTCCTGAG -3'
(R):5'- GATGTTTACCTGTTGTCCCTCGAG -3'
Posted On2015-07-21