Incidental Mutation 'R4450:Cldn12'
ID328915
Institutional Source Beutler Lab
Gene Symbol Cldn12
Ensembl Gene ENSMUSG00000046798
Gene Nameclaudin 12
Synonyms
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5489537-5514958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5508398 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000136988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060947] [ENSMUST00000115445] [ENSMUST00000115446] [ENSMUST00000125110] [ENSMUST00000179804]
Predicted Effect probably damaging
Transcript: ENSMUST00000060947
AA Change: T10A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061928
Gene: ENSMUSG00000046798
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115445
AA Change: T10A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111105
Gene: ENSMUSG00000046798
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115446
AA Change: T10A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111106
Gene: ENSMUSG00000046798
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134931
Predicted Effect probably damaging
Transcript: ENSMUST00000179804
AA Change: T10A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136988
Gene: ENSMUSG00000046798
AA Change: T10A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198303
Meta Mutation Damage Score 0.1093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene, along with several other family members, is expressed in the inner ear. The protein encoded by this gene and another family member, claudin 2, are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Cldn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03323:Cldn12 APN 5 5508421 missense probably damaging 1.00
R1499:Cldn12 UTSW 5 5507900 missense probably benign 0.28
R1971:Cldn12 UTSW 5 5508137 missense probably benign 0.16
R2350:Cldn12 UTSW 5 5507845 missense possibly damaging 0.55
R4665:Cldn12 UTSW 5 5508385 missense probably damaging 1.00
R4724:Cldn12 UTSW 5 5508385 missense probably damaging 1.00
R4725:Cldn12 UTSW 5 5508385 missense probably damaging 1.00
R4728:Cldn12 UTSW 5 5508385 missense probably damaging 1.00
R6961:Cldn12 UTSW 5 5507707 missense probably damaging 1.00
R7485:Cldn12 UTSW 5 5508008 missense probably benign 0.06
R7857:Cldn12 UTSW 5 5508209 missense probably benign
R7940:Cldn12 UTSW 5 5508209 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTTCCATCATACCGGG -3'
(R):5'- TGCACTTGATCTGGGACATATG -3'

Sequencing Primer
(F):5'- ATCATACCGGGCACACTTC -3'
(R):5'- GCTAGGATTGCACTAGCTAGCTC -3'
Posted On2015-07-21