Mutagenetix > Incidental Mutations

Incidental Mutation 'R4450:Speer3'

328916

Institutional Source

Beutler Lab

Gene Symbol

Speer3

Ensembl Gene

ENSMUSG00000067855

Gene Name

spermatogenesis associated glutamate (E)-rich protein 3

Synonyms

SPEER-3, 4933405P08Rik

MMRRC Submission

041711-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R4450 (G1)

Quality Score

130

Status

Not validated

Chromosome

Chromosomal Location

13791619-13796820 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 13796380 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 238 (A238G)

Ref Sequence

ENSEMBL: ENSMUSP00000115668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124677]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124677
AA Change: A238G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115668
Gene: ENSMUSG00000067855
AA Change: A238G

Domain	Start	End	E-Value	Type
Pfam:Takusan	48	134	2.3e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199961

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsl6	A	G	11: 54,328,403	D278G	probably damaging	Het
Adamdec1	C	T	14: 68,573,119	R196Q	probably benign	Het
Akap13	T	A	7: 75,742,760	F2450L	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Angel1	A	T	12: 86,721,924	Y262N	probably damaging	Het
Arhgef18	A	G	8: 3,437,097	E272G	probably damaging	Het
Bpifb6	A	G	2: 153,906,768	E228G	possibly damaging	Het
Brca2	T	G	5: 150,536,053	D264E	probably damaging	Het
Cdca4	T	C	12: 112,821,658	N150S	probably benign	Het
Cep162	T	C	9: 87,225,808	S510G	probably damaging	Het
Cldn12	T	C	5: 5,508,398	T10A	probably damaging	Het
Clip2	C	T	5: 134,502,953	G631D	possibly damaging	Het
Col19a1	T	A	1: 24,322,035	T625S	probably damaging	Het
Col6a5	C	T	9: 105,904,521	G1635D	unknown	Het
Dcp1b	A	G	6: 119,206,476	T175A	probably benign	Het
Eln	C	T	5: 134,725,781		probably benign	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm9894	T	A	13: 67,765,080		noncoding transcript	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hrasls	C	T	16: 29,228,224	T165M	possibly damaging	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Klhl42	G	A	6: 147,091,671	G47D	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lzts2	A	T	19: 45,023,593	K154*	probably null	Het
Map4k3	C	T	17: 80,603,982		probably null	Het
Mlc1	A	G	15: 88,963,490	F285S	probably benign	Het
Myo5a	T	A	9: 75,167,176	M789K	probably benign	Het
Nbeal1	T	A	1: 60,267,774	S319T	probably damaging	Het
Nsun4	A	T	4: 116,051,256	Y702*	probably null	Het
Olfr917	A	T	9: 38,665,754	V30E	probably benign	Het
Olfr954	G	A	9: 39,462,032	M200I	probably benign	Het
Osbpl5	T	A	7: 143,694,906	T640S	probably benign	Het
Rangrf	A	T	11: 68,975,184		probably benign	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Ros1	C	T	10: 52,077,942	G1867D	probably damaging	Het
Slc11a1	C	A	1: 74,385,535		probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Syt6	A	G	3: 103,585,645	H156R	probably benign	Het
Tln2	C	T	9: 67,344,065		probably null	Het
Trim58	T	C	11: 58,651,365	W384R	probably benign	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het

Other mutations in Speer3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01663:Speer3	APN	5	13793222	nonsense	probably null
IGL02730:Speer3	APN	5	13793271	missense	probably benign
IGL03192:Speer3	APN	5	13791688	missense	possibly damaging	0.93
IGL03301:Speer3	APN	5	13795433	missense	probably damaging	1.00
R1623:Speer3	UTSW	5	13796321	missense	probably benign
R3028:Speer3	UTSW	5	13795431	missense	probably damaging	0.99
R4091:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4092:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4368:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4369:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4405:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4509:Speer3	UTSW	5	13796354	missense	possibly damaging	0.72
R4594:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R4702:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R5096:Speer3	UTSW	5	13796380	missense	possibly damaging	0.70
R5508:Speer3	UTSW	5	13794664	missense	probably damaging	0.97
R5583:Speer3	UTSW	5	13794768	critical splice donor site	probably null
R6061:Speer3	UTSW	5	13794691	missense	possibly damaging	0.88
R6337:Speer3	UTSW	5	13793355	missense	probably damaging	0.96
R6518:Speer3	UTSW	5	13795448	missense	possibly damaging	0.66
R7503:Speer3	UTSW	5	13793334	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GCCCTGCATGTATAGAACAGC -3'
(R):5'- CAGACCTACAGCCTGTATCTCC -3'

Sequencing Primer
(F):5'- CCCTGCATGTATAGAACAGCAATGG -3'
(R):5'- AGCCTGTATCTCCTCTTGGACTG -3'

Posted On

2015-07-21