Incidental Mutation 'R4450:Speer3'
ID 328916
Institutional Source Beutler Lab
Gene Symbol Speer3
Ensembl Gene ENSMUSG00000067855
Gene Name spermatogenesis associated glutamate (E)-rich protein 3
Synonyms SPEER-3, 4933405P08Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4450 (G1)
Quality Score 130
Status Not validated
Chromosome 5
Chromosomal Location 13791619-13796820 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 13796380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 238 (A238G)
Ref Sequence ENSEMBL: ENSMUSP00000115668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124677]
AlphaFold W4VSP1
Predicted Effect possibly damaging
Transcript: ENSMUST00000124677
AA Change: A238G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115668
Gene: ENSMUSG00000067855
AA Change: A238G

DomainStartEndE-ValueType
Pfam:Takusan 48 134 2.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199961
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Speer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Speer3 APN 5 13793222 nonsense probably null
IGL02730:Speer3 APN 5 13793271 missense probably benign
IGL03192:Speer3 APN 5 13791688 missense possibly damaging 0.93
IGL03301:Speer3 APN 5 13795433 missense probably damaging 1.00
R1623:Speer3 UTSW 5 13796321 missense probably benign
R3028:Speer3 UTSW 5 13795431 missense probably damaging 0.99
R4091:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4092:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4368:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4369:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4405:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4509:Speer3 UTSW 5 13796354 missense possibly damaging 0.72
R4594:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4702:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5096:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5508:Speer3 UTSW 5 13794664 missense probably damaging 0.97
R5583:Speer3 UTSW 5 13794768 critical splice donor site probably null
R6061:Speer3 UTSW 5 13794691 missense possibly damaging 0.88
R6337:Speer3 UTSW 5 13793355 missense probably damaging 0.96
R6518:Speer3 UTSW 5 13795448 missense possibly damaging 0.66
R7503:Speer3 UTSW 5 13793334 missense probably benign 0.30
R9456:Speer3 UTSW 5 13796354 missense
Predicted Primers PCR Primer
(F):5'- GCCCTGCATGTATAGAACAGC -3'
(R):5'- CAGACCTACAGCCTGTATCTCC -3'

Sequencing Primer
(F):5'- CCCTGCATGTATAGAACAGCAATGG -3'
(R):5'- AGCCTGTATCTCCTCTTGGACTG -3'
Posted On 2015-07-21