Incidental Mutation 'R4450:Slc15a4'
ID328917
Institutional Source Beutler Lab
Gene Symbol Slc15a4
Ensembl Gene ENSMUSG00000029416
Gene Namesolute carrier family 15, member 4
SynonymsPHT1, C130069N12Rik, PTR4
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location127595664-127632897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127604536 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031367] [ENSMUST00000152727] [ENSMUST00000152727] [ENSMUST00000153832] [ENSMUST00000155321]
Predicted Effect probably null
Transcript: ENSMUST00000031367
SMART Domains Protein: ENSMUSP00000031367
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Pfam:MFS_1 33 505 7.8e-13 PFAM
Pfam:PTR2 96 519 3.6e-127 PFAM
transmembrane domain 533 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124569
SMART Domains Protein: ENSMUSP00000121595
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTR2 49 242 8.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144603
SMART Domains Protein: ENSMUSP00000116420
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 127 2.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152727
SMART Domains Protein: ENSMUSP00000116529
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 1 81 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153832
SMART Domains Protein: ENSMUSP00000123116
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Pfam:PTR2 96 292 5e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155321
SMART Domains Protein: ENSMUSP00000117258
Gene: ENSMUSG00000029416

DomainStartEndE-ValueType
Pfam:PTR2 7 105 1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect probably null
Transcript: ENSMUST00000198486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200212
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation display abrogation of both Toll-like receptor (TLR)-induced type I IFN and proinflammatory cytokine production by plasmacytoid dendritic cells. Conventional dendritic cells respond normally to TLR ligands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Slc15a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc15a4 APN 5 127601960 missense probably benign 0.13
IGL01543:Slc15a4 APN 5 127603766 missense probably benign 0.12
IGL01805:Slc15a4 APN 5 127608836 missense possibly damaging 0.91
IGL02958:Slc15a4 APN 5 127604665 missense possibly damaging 0.93
IGL03367:Slc15a4 APN 5 127601941 missense probably damaging 1.00
feeble UTSW 5 127608770 unclassified probably benign
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0018:Slc15a4 UTSW 5 127602010 missense probably damaging 1.00
R0838:Slc15a4 UTSW 5 127617003 missense possibly damaging 0.53
R1544:Slc15a4 UTSW 5 127603768 missense probably benign 0.01
R1662:Slc15a4 UTSW 5 127608979 missense probably damaging 1.00
R2504:Slc15a4 UTSW 5 127617239 missense possibly damaging 0.92
R2843:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2845:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2846:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2900:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R2971:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3018:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3020:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3021:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3027:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3053:Slc15a4 UTSW 5 127596682 missense possibly damaging 0.83
R3155:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R3432:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4356:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4357:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4359:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4448:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4449:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4514:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4544:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4546:Slc15a4 UTSW 5 127604536 critical splice donor site probably null
R4952:Slc15a4 UTSW 5 127603837 missense probably damaging 1.00
R5278:Slc15a4 UTSW 5 127616969 missense probably damaging 0.99
R6393:Slc15a4 UTSW 5 127616886 missense probably benign 0.13
R6527:Slc15a4 UTSW 5 127596709 missense probably damaging 1.00
R7409:Slc15a4 UTSW 5 127604678 missense probably benign 0.04
Z1177:Slc15a4 UTSW 5 127600524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCAGGCACCCAAATG -3'
(R):5'- TTGTCACTAGGGGTGGAAGTAAAC -3'

Sequencing Primer
(F):5'- TTCCAGGCACCCAAATGACAAAG -3'
(R):5'- TGTTTCCCAAAGTGAAGGCC -3'
Posted On2015-07-21