Mutagenetix > Incidental Mutations

Incidental Mutation 'R4450:Clip2'

328918

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

WSCR4, Cyln2, CLIP-115

MMRRC Submission

041711-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.290) question?

Stock #

R4450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134489383-134552434 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 134502953 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 631 (G631D)

Ref Sequence

ENSEMBL: ENSMUSP00000037431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036999
AA Change: G631D

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: G631D

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100647
AA Change: G666D

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: G666D

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Meta Mutation Damage Score

0.0862

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsl6	A	G	11: 54,328,403	D278G	probably damaging	Het
Adamdec1	C	T	14: 68,573,119	R196Q	probably benign	Het
Akap13	T	A	7: 75,742,760	F2450L	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Angel1	A	T	12: 86,721,924	Y262N	probably damaging	Het
Arhgef18	A	G	8: 3,437,097	E272G	probably damaging	Het
Bpifb6	A	G	2: 153,906,768	E228G	possibly damaging	Het
Brca2	T	G	5: 150,536,053	D264E	probably damaging	Het
Cdca4	T	C	12: 112,821,658	N150S	probably benign	Het
Cep162	T	C	9: 87,225,808	S510G	probably damaging	Het
Cldn12	T	C	5: 5,508,398	T10A	probably damaging	Het
Col19a1	T	A	1: 24,322,035	T625S	probably damaging	Het
Col6a5	C	T	9: 105,904,521	G1635D	unknown	Het
Dcp1b	A	G	6: 119,206,476	T175A	probably benign	Het
Eln	C	T	5: 134,725,781		probably benign	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm9894	T	A	13: 67,765,080		noncoding transcript	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hrasls	C	T	16: 29,228,224	T165M	possibly damaging	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Klhl42	G	A	6: 147,091,671	G47D	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lzts2	A	T	19: 45,023,593	K154*	probably null	Het
Map4k3	C	T	17: 80,603,982		probably null	Het
Mlc1	A	G	15: 88,963,490	F285S	probably benign	Het
Myo5a	T	A	9: 75,167,176	M789K	probably benign	Het
Nbeal1	T	A	1: 60,267,774	S319T	probably damaging	Het
Nsun4	A	T	4: 116,051,256	Y702*	probably null	Het
Olfr917	A	T	9: 38,665,754	V30E	probably benign	Het
Olfr954	G	A	9: 39,462,032	M200I	probably benign	Het
Osbpl5	T	A	7: 143,694,906	T640S	probably benign	Het
Rangrf	A	T	11: 68,975,184		probably benign	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Ros1	C	T	10: 52,077,942	G1867D	probably damaging	Het
Slc11a1	C	A	1: 74,385,535		probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Syt6	A	G	3: 103,585,645	H156R	probably benign	Het
Tln2	C	T	9: 67,344,065		probably null	Het
Trim58	T	C	11: 58,651,365	W384R	probably benign	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134500157	splice site	probably benign
IGL01024:Clip2	APN	5	134510212	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134492350	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134522664	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134498084	splice site	probably benign
IGL02174:Clip2	APN	5	134494264	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134503130	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134502571	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134518022	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134510159	splice site	probably benign
IGL03198:Clip2	APN	5	134498082	splice site	probably benign
IGL03269:Clip2	APN	5	134516894	missense	probably damaging	1.00
scissors	UTSW	5	134517999	nonsense	probably null
R0335:Clip2	UTSW	5	134535215	start gained	probably benign
R0422:Clip2	UTSW	5	134498113	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134516151	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134492250	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134503253	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134502929	nonsense	probably null
R1822:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134503115	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134523064	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134492253	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134535197	start gained	probably benign
R4239:Clip2	UTSW	5	134535197	start gained	probably benign
R4294:Clip2	UTSW	5	134492313	missense	probably benign	0.09
R4741:Clip2	UTSW	5	134516269	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134514048	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134502779	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134491925	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134522630	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134496241	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134502917	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134502630	nonsense	probably null
R7725:Clip2	UTSW	5	134517999	nonsense	probably null
R8380:Clip2	UTSW	5	134502797	missense	probably damaging	0.96
R8680:Clip2	UTSW	5	134502608	missense	probably benign
X0062:Clip2	UTSW	5	134503136	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134516835	missense	probably damaging	0.98
Z1177:Clip2	UTSW	5	134522999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAACTCGATGGCTTGAGC -3'
(R):5'- GGCTCATGGACAACTGGAAATC -3'

Sequencing Primer
(F):5'- CGACATTGGTCCTGGGCTTC -3'
(R):5'- CATGGACAACTGGAAATCCAAGCTG -3'

Posted On

2015-07-21