Incidental Mutation 'R0044:Slc16a7'
ID 32892
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
MMRRC Submission 038338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0044 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125228082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably benign
Transcript: ENSMUST00000063318
AA Change: D462G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: D462G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105257
AA Change: D462G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: D462G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210780
AA Change: D462G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000211781
AA Change: D462G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Bpifb2 C T 2: 153,882,679 probably benign Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Dido1 C T 2: 180,661,819 A1431T probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gbe1 T A 16: 70,561,132 Y681* probably null Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lpin1 A T 12: 16,568,529 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tmtc1 A G 6: 148,412,829 probably benign Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125228051 missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125231011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCACCATCTCAAGAGTTGACCATCC -3'
(R):5'- GCGGAACAGTCGTGTTAGTATCAGG -3'

Sequencing Primer
(F):5'- AGGAAGATGCCAGTTTTGTTAC -3'
(R):5'- GTACTTACCTCCTGATTGGCAATG -3'
Posted On 2013-05-09