Incidental Mutation 'R4450:Dcp1b'
ID328921
Institutional Source Beutler Lab
Gene Symbol Dcp1b
Ensembl Gene ENSMUSG00000041477
Gene Namedecapping mRNA 1B
SynonymsB930050E02Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119175253-119221616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119206476 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 175 (T175A)
Ref Sequence ENSEMBL: ENSMUSP00000108397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073909] [ENSMUST00000112777]
Predicted Effect probably benign
Transcript: ENSMUST00000073909
AA Change: T175A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000073568
Gene: ENSMUSG00000041477
AA Change: T175A

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 10 131 1.3e-53 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112777
AA Change: T175A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000108397
Gene: ENSMUSG00000041477
AA Change: T175A

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 13 129 3e-46 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:mRNA_decap_C 536 578 2.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149651
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Dcp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Dcp1b APN 6 119215358 missense probably damaging 0.96
IGL01320:Dcp1b APN 6 119215075 missense probably benign 0.29
IGL01348:Dcp1b APN 6 119183718 missense probably damaging 1.00
IGL01635:Dcp1b APN 6 119206537 missense probably damaging 1.00
IGL02888:Dcp1b APN 6 119220087 utr 3 prime probably benign
IGL03280:Dcp1b APN 6 119180058 intron probably benign
R1672:Dcp1b UTSW 6 119217911 missense probably benign
R2395:Dcp1b UTSW 6 119215064 missense probably benign
R2421:Dcp1b UTSW 6 119215266 missense probably benign 0.28
R2512:Dcp1b UTSW 6 119206512 missense possibly damaging 0.69
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R5394:Dcp1b UTSW 6 119175367 missense probably damaging 1.00
R5688:Dcp1b UTSW 6 119217911 missense probably benign
R7734:Dcp1b UTSW 6 119215283 missense probably benign 0.00
R7752:Dcp1b UTSW 6 119175357 missense possibly damaging 0.64
R7847:Dcp1b UTSW 6 119215295 missense probably benign
R8274:Dcp1b UTSW 6 119183651 missense probably damaging 1.00
R8325:Dcp1b UTSW 6 119215436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAAGTAAGCACATGGCCTCC -3'
(R):5'- GACTTTTGGGATAGCATTGGAAATG -3'

Sequencing Primer
(F):5'- AGCTCCCCAATAGCATGTGG -3'
(R):5'- TTGGGATAGCATTGGAAATGTAAATG -3'
Posted On2015-07-21