Incidental Mutation 'R4450:Osbpl5'
ID328924
Institutional Source Beutler Lab
Gene Symbol Osbpl5
Ensembl Gene ENSMUSG00000037606
Gene Nameoxysterol binding protein-like 5
SynonymsObph1, ORP5, 1110006M06Rik
MMRRC Submission 041711-MU
Accession Numbers

Genbank: NM_024289 ; MGI: 1930265

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143688762-143756985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143694906 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 640 (T640S)
Ref Sequence ENSEMBL: ENSMUSP00000020411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020411] [ENSMUST00000119499]
Predicted Effect probably benign
Transcript: ENSMUST00000020411
AA Change: T640S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020411
Gene: ENSMUSG00000037606
AA Change: T640S

DomainStartEndE-ValueType
PH 151 269 1.02e-14 SMART
Pfam:Oxysterol_BP 394 738 2.9e-91 PFAM
transmembrane domain 879 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119499
AA Change: T616S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113362
Gene: ENSMUSG00000037606
AA Change: T616S

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121409
AA Change: T616S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113375
Gene: ENSMUSG00000037606
AA Change: T616S

DomainStartEndE-ValueType
coiled coil region 92 122 N/A INTRINSIC
PH 127 245 1.02e-14 SMART
Pfam:Oxysterol_BP 369 724 1e-93 PFAM
transmembrane domain 855 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140502
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors that play a key role in the maintenance of cholesterol balance in the body. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. This gene has been shown to be imprinted, with preferential expression from the maternal allele only in placenta. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Osbpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Osbpl5 APN 7 143715693 nonsense probably null
IGL01996:Osbpl5 APN 7 143707344 critical splice donor site probably null
IGL02135:Osbpl5 APN 7 143705125 missense probably damaging 1.00
IGL02331:Osbpl5 APN 7 143709795 missense probably benign 0.22
IGL02993:Osbpl5 APN 7 143699334 critical splice acceptor site probably null
R0240:Osbpl5 UTSW 7 143741669 splice site probably null
R0601:Osbpl5 UTSW 7 143709549 missense probably damaging 0.98
R0609:Osbpl5 UTSW 7 143694821 missense probably damaging 0.99
R0659:Osbpl5 UTSW 7 143705030 missense probably damaging 0.97
R1532:Osbpl5 UTSW 7 143695080 missense probably benign
R1579:Osbpl5 UTSW 7 143709202 missense possibly damaging 0.93
R1595:Osbpl5 UTSW 7 143703218 missense possibly damaging 0.88
R1666:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1668:Osbpl5 UTSW 7 143709039 missense probably damaging 1.00
R1713:Osbpl5 UTSW 7 143694373 missense probably damaging 1.00
R1868:Osbpl5 UTSW 7 143715773 missense probably damaging 1.00
R1901:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1902:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1903:Osbpl5 UTSW 7 143703181 missense possibly damaging 0.83
R1911:Osbpl5 UTSW 7 143689925 missense probably benign 0.00
R1982:Osbpl5 UTSW 7 143741671 critical splice donor site probably null
R2014:Osbpl5 UTSW 7 143741692 missense probably damaging 0.98
R2076:Osbpl5 UTSW 7 143709144 missense probably damaging 1.00
R2192:Osbpl5 UTSW 7 143693859 nonsense probably null
R2256:Osbpl5 UTSW 7 143709094 missense probably damaging 1.00
R4271:Osbpl5 UTSW 7 143695602 nonsense probably null
R4418:Osbpl5 UTSW 7 143709815 nonsense probably null
R4573:Osbpl5 UTSW 7 143694316 missense probably benign 0.00
R5325:Osbpl5 UTSW 7 143691928 missense probably damaging 0.99
R5439:Osbpl5 UTSW 7 143741696 missense possibly damaging 0.83
R5617:Osbpl5 UTSW 7 143692947 missense possibly damaging 0.89
R5775:Osbpl5 UTSW 7 143704529 missense probably benign 0.00
R5935:Osbpl5 UTSW 7 143756958 start gained probably benign
R6906:Osbpl5 UTSW 7 143694328 missense probably damaging 0.99
R7076:Osbpl5 UTSW 7 143709840 missense probably benign 0.12
R7117:Osbpl5 UTSW 7 143709783 missense probably benign 0.01
R7292:Osbpl5 UTSW 7 143701278 missense probably damaging 1.00
R7555:Osbpl5 UTSW 7 143694933 missense possibly damaging 0.65
R7594:Osbpl5 UTSW 7 143693797 missense probably benign 0.02
R8061:Osbpl5 UTSW 7 143702724 missense probably benign 0.03
YA93:Osbpl5 UTSW 7 143693870 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACACCCTAGAATGTGCTCCC -3'
(R):5'- CAACATCAACCAGATTTCCGGG -3'

Sequencing Primer
(F):5'- CAGCATCGTGACCCTGAC -3'
(R):5'- CCAGATTTCCGGGAAGATCATGTC -3'
Posted On2015-07-21