Incidental Mutation 'R4450:Galnt2'
ID 328930
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Name polypeptide N-acetylgalactosaminyltransferase 2
Synonyms ppGaNTase-T2
MMRRC Submission 041711-MU
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R4450 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 124231391-124345724 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124295377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 14 (D14G)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
AlphaFold Q6PB93
Predicted Effect probably benign
Transcript: ENSMUST00000034458
AA Change: D48G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: D48G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
AA Change: D14G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: D14G

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147911
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
chivalry UTSW 8 124334286 nonsense probably null
feudal UTSW 8 124332098 critical splice donor site probably null
gallantry UTSW 8 124340822 missense probably damaging 1.00
valor UTSW 8 124329788 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R8348:Galnt2 UTSW 8 124334286 nonsense probably null
R8770:Galnt2 UTSW 8 124334286 nonsense probably null
R8826:Galnt2 UTSW 8 124305608 missense probably damaging 1.00
R9054:Galnt2 UTSW 8 124332098 critical splice donor site probably null
R9269:Galnt2 UTSW 8 124338463 missense probably benign 0.02
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGCGTAGTCTAGACGTCTCTG -3'
(R):5'- GCAGTGTCCAGAAGCATAAGTC -3'

Sequencing Primer
(F):5'- CTAGACGTCTCTGGGTGATTATGAG -3'
(R):5'- GTGTCCAGAAGCATAAGTCATTCTC -3'
Posted On 2015-07-21