Incidental Mutation 'R4450:Cep162'
ID328935
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87225808 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 510 (S510G)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably damaging
Transcript: ENSMUST00000093802
AA Change: S510G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: S510G

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188289
Meta Mutation Damage Score 0.0889 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7924:Cep162 UTSW 9 87244316 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATGCACTCTATGTATCCAGTTC -3'
(R):5'- GCTAATCACAATCTTGCCATCTG -3'

Sequencing Primer
(F):5'- ACTCTATGTATCCAGTTCTGTCTTG -3'
(R):5'- GCGGTTGAAGTTCATTCTAATACTAG -3'
Posted On2015-07-21